CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Target MGE spacer number
LR135178	Enterococcus faecium isolate E4402 genome assembly, plasmid: 5	0 crisprs	NA	0
LR135176	Enterococcus faecium isolate E4402 genome assembly, plasmid: 3	0 crisprs	NA	0
LR135175	Enterococcus faecium isolate E4402 genome assembly, plasmid: 2	1 crisprs	NA	2
LR135177	Enterococcus faecium isolate E4402 genome assembly, plasmid: 4	0 crisprs	NA	0
LR135174	Enterococcus faecium isolate E4402 genome assembly, chromosome: 1	1 crisprs	NA	0

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: LR135175_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

LR135175_1

430-557

Orphan

Consensus_repeat	Method
TCAGAGGGTATGAAAATCATACC	CRISPRCasFinder

2 spacers

The CRISPR arrays of LR135175_1

>merge|LR135175|1|430-557|CRISPRCasFinder
TCAGAGGGTATGAAAATCATACCCACCCTCGACGAAAAATCAGGCGCTGAATCCCTTGGGGCTCAAGAGGGTATGAAAATCATACCGTGCCAAAACGTTGATAAATCAGAGGGTATGAAAATCATACC

>LR135175|1|1|430-557|CRISPRCasFinder
TCAGAGGGTATGAAAATCATACC	CACCCTCGACGAAAAATCAGGCGCTGAATCCCTTGGGGCT
CAAGAGGGTATGAAAATCATACC	GTGCCAAAACGTTGATAAA
TCAGAGGGTATGAAAATCATACC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	109447-109486	0	1.0
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	453-492	0	1.0
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	453-492	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	221173-221191	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040906	Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence	51712-51730	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	109405-109423	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	358162-358180	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	119894-119912	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040905	Enterococcus faecium strain N56454 plasmid unnamed, complete sequence	153578-153596	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP041256	Enterococcus faecium strain 515 plasmid p26, complete sequence	129169-129187	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	249075-249093	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	91359-91377	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	102383-102401	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	60319-60337	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	97634-97652	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	52594-52612	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	102608-102626	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	56500-56518	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	65290-65308	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	14529-14547	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	33039-33057	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	39844-39862	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP033207	Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence	92003-92021	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	17046-17064	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	47586-47604	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	192070-192088	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	168220-168238	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP011282	Enterococcus faecium strain E39 plasmid p1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	LT603679	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2	515-533	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	244189-244207	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP043485	Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence	27946-27964	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	96610-96628	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	517-535	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP018073	Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence	111433-111451	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135288	Enterococcus faecium isolate E7199 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135333	Enterococcus faecium isolate E7471 plasmid 3	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	126997-127015	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135244	Enterococcus faecium isolate E6988 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135279	Enterococcus faecium isolate E6975 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135255	Enterococcus faecium isolate E7098 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135236	Enterococcus faecium isolate E7067 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135182	Enterococcus faecium isolate E1774 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	71332-71350	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP017798	Enterococcus faecium strain E243 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135227	Enterococcus faecium isolate E7025 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135220	Enterococcus faecium isolate E7040 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NC_021987	Enterococcus faecium Aus0085 plasmid p1, complete sequence	107261-107279	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135325	Enterococcus faecium isolate E7654 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135318	Enterococcus faecium isolate E7663 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR134106	Enterococcus faecium isolate E6043 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	1460-1478	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP045013	Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	200693-200711	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	67391-67409	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040873	Enterococcus faecium strain DB-1 plasmid punnamed1	40046-40064	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040876	Enterococcus faecium strain DB-1 plasmid punnamed2	2896-2914	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP017793	Enterococcus faecium strain E240 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	178961-178979	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	105772-105790	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_LR135308	Enterococcus faecium isolate E7240 plasmid 2	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	225675-225693	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	86230-86248	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_AP019409	Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	61716-61734	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	5147-5165	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	177341-177359	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	244189-244207	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_MG674581	Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence	516-534	0	1.0
LR135175_1	1.2\|516\|19\|LR135175\|CRISPRCasFinder	516-534	19	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	516-534	0	1.0
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	221215-221254	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP012385	Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence	95091-95130	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	358204-358243	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	119936-119975	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040905	Enterococcus faecium strain N56454 plasmid unnamed, complete sequence	153620-153659	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP041256	Enterococcus faecium strain 515 plasmid p26, complete sequence	129211-129250	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	249117-249156	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	91401-91440	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	102425-102464	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	60361-60400	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	97676-97715	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	52636-52675	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	102650-102689	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	56542-56581	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	65332-65371	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	14571-14610	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	33081-33120	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	39886-39925	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP033207	Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence	92045-92084	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	17088-17127	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	192112-192151	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	168262-168301	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP011282	Enterococcus faecium strain E39 plasmid p1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	LT603679	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2	452-491	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	244126-244165	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP043485	Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence	27883-27922	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	96547-96586	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	454-493	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP018073	Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence	111370-111409	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135288	Enterococcus faecium isolate E7199 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135333	Enterococcus faecium isolate E7471 plasmid 3	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	126934-126973	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135244	Enterococcus faecium isolate E6988 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135279	Enterococcus faecium isolate E6975 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135255	Enterococcus faecium isolate E7098 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135236	Enterococcus faecium isolate E7067 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135182	Enterococcus faecium isolate E1774 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	71269-71308	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP017798	Enterococcus faecium strain E243 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135180	Enterococcus faecium isolate E0595 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135227	Enterococcus faecium isolate E7025 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135220	Enterococcus faecium isolate E7040 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NC_021987	Enterococcus faecium Aus0085 plasmid p1, complete sequence	107198-107237	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135325	Enterococcus faecium isolate E7654 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135318	Enterococcus faecium isolate E7663 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR134106	Enterococcus faecium isolate E6043 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	1397-1436	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR132068	Enterococcus faecium isolate E0139 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	200630-200669	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	67328-67367	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP017793	Enterococcus faecium strain E240 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	178898-178937	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	105709-105748	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP037956	Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence	35165-35204	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_LR135308	Enterococcus faecium isolate E7240 plasmid 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	225612-225651	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	86167-86206	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_AP019409	Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	61653-61692	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	5084-5123	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	177278-177317	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	244126-244165	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	LR135186	Enterococcus faecium isolate E4413 genome assembly, plasmid: 2	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_MG674581	Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	453-492	1	0.975
LR135175_1	1.1\|453\|40\|LR135175\|CRISPRCasFinder	453-492	40	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	47628-47667	2	0.95

1. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
****************************************

2. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
****************************************

3. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
****************************************

4. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

5. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

6. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

7. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

8. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

9. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

10. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

11. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

12. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

13. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

14. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

15. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

16. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

17. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

18. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

19. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

20. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

21. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

22. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

23. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

24. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

25. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

26. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

27. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

28. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

29. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

30. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

31. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

32. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

33. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

34. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

35. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

36. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

37. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

38. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

39. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

40. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

41. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

42. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

43. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

44. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

45. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

46. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

47. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

48. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

49. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

50. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

51. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

52. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

53. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

54. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

55. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

56. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

57. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

58. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

59. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

60. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

61. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

62. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

63. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

64. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

65. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

66. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

67. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

68. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

69. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

70. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

71. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

72. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

73. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

74. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

75. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

76. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

77. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

78. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

79. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

80. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

81. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

82. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

83. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

84. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

85. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

86. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

87. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

88. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

89. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

90. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

91. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

92. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

93. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

94. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

95. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

96. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

97. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

98. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

99. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

100. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

101. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

102. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

103. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

104. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

105. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

106. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

107. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

108. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

109. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

110. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

111. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

112. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

113. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

114. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

115. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

116. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

117. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

118. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

119. spacer 1.2|516|19|LR135175|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

120. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

121. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

122. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

123. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

124. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

125. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

126. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

127. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

128. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

129. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

130. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

131. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

132. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

133. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

134. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

135. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

136. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

137. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

138. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

139. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

140. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

141. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

142. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

143. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

144. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

145. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

146. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

147. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

148. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

149. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

150. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

151. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

152. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

153. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

154. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

155. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

156. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

157. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

158. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

159. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

160. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

161. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

162. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

163. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

164. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

165. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

166. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

167. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

168. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

169. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

170. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

171. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

172. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

173. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

174. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

175. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

176. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

177. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

178. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

179. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

180. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

181. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

182. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

183. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

184. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

185. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

186. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

187. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

188. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

189. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

190. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

191. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

192. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

193. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

194. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

195. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

196. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

197. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

198. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

199. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

200. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

201. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

202. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

203. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

204. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

205. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

206. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

207. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

208. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

209. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

210. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

211. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

212. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

213. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

214. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

215. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

216. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

217. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

218. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

219. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

220. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

221. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

222. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

223. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

224. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

225. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

226. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

227. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

228. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

229. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

230. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

231. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

232. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
********************.*******************

233. spacer 1.1|453|40|LR135175|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 2, identity: 0.95

caccctcgacgaaaaatcaggcgctgaatcccttggggct	CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
**.*****************.*******************

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

2. LR135174

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: LR135174_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

LR135174_1

2334301-2334410

Orphan

Consensus_repeat	Method
CTTTGCTCAACCAGTATTATTCATCA	CRISPRCasFinder

1 spacers

The CRISPR arrays of LR135174_1

>merge|LR135174|1|2334301-2334410|CRISPRCasFinder
CTTTGCTCAACCAGTATTATTCATCACCTATTCACTTCGTTCATAGTGATTCTACTCGCTTTGCTCGAAAGGAAACTCCTTTCGCTTTGCTCAACCAGTATTGTTCATCA

>LR135174|1|1|2334301-2334410|CRISPRCasFinder
CTTTGCTCAACCAGTATTATTCATCA	CCTATTCACTTCGTTCATAGTGATTCTACTCGCTTTGCTCGAAAGGAAACTCCTTTCG
CTTTGCTCAACCAGTATTGTTCATCA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

Overview of predicted results

Overview of the results

Cas Category Instructions

Results visualization

1. LR135175

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection

2. LR135174

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection