CRISPRimmunity

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
LR135255	Enterococcus faecium isolate E7098 genome assembly, plasmid: 2	1 crisprs	NA	0	2	0	0
LR135254	Enterococcus faecium isolate E7098 genome assembly, chromosome: 1	1 crisprs	NA	0	0	0	0
LR135257	Enterococcus faecium isolate E7098 genome assembly, plasmid: 4	0 crisprs	NA	0	0	0	0
LR135256	Enterococcus faecium isolate E7098 genome assembly, plasmid: 3	1 crisprs	NA	1	4	0	0

1. LR135256

CRISPR-Cas detection and classification

Crispr_ID: LR135256_1

• CRISPR_ID: LR135256_1
• CRISPR_location: 11209-11377
• CRISPR_type: Orphan
• Repeat_type: NA
• Spacer_info: 2 spacers

Consensus repeat of LR135256_1

Consensus_repeat	Method
ATTTGAGAAACATGCTGTTTTATATGGTTCTAAAAC	CRISPRCasFinder
AATTTGAGAAACATGCTGTTTTATATGGTTCTAAAAC	PILER-CR

spacers of LR135256_1

>1.1|11245|30|LR135256|CRISPRCasFinder
AGGAACGCCATCAATTAATTTAAAGTACTC
>1.2|11311|30|LR135256|CRISPRCasFinder
AAACTGCTAGCAATTTCCCTTATCCTAAAA
>1.3|11262|27|LR135256|PILER-CR
GCAGGAACGCCATCAATTAATTTAAAG
>1.4|11332|29|LR135256|PILER-CR
AAACTGCTAGCAATTTCCCTTATCCTAAA

CRISPR arrays and Neighbor proteins around LR135256_1

CRISPR arrays

The CRISPR arrays of LR135256_1

>merge|LR135256|1|11209-11377|CRISPRCasFinder,PILER-CR
GTTTTAAATCCATGTTGTTTTATATGGTTCTAAAGCAGGAACGCCATCAATTAATTTAAAGTACTCATTTGAGAAACATGCTGTTTTATATGGTTCTAAAACAAACTGCTAGCAATTTCCCTTATCCTAAAAATTTGAGAAACATGCTGTTTTATATGGTTCTAAAACC

>LR135256|1|1|11209-11376|CRISPRCasFinder
GTTTTAAATCCATGTTGTTTTATATGGTTCTAAAGC	AGGAACGCCATCAATTAATTTAAAGTACTC
ATTTGAGAAACATGCTGTTTTATATGGTTCTAAAAC	AAACTGCTAGCAATTTCCCTTATCCTAAAA
ATTTGAGAAACATGCTGTTTTATATGGTTCTAAAAC

>LR135256|1|1|11219-11377|PILER-CR
CATGTTGTTTTATATGGTTCTAAAGCAGGAACGCCATCAATTA	ATTTAAAGTACTCATTTGAGAAACATG
CTGTTTTATATGGTTCTAAAACAAACTGCTAGCAATTTCCCTT	ATCCTAAAAATTTGAGAAACATGCTGTTT
TATATGGTTCTAAAACC

Protein sequences

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	LR135257.1	8492-8521	1	0.967

1. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to position: 8492-8521, mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041263	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2	11556-11585	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135245	Enterococcus faecium isolate E6988 plasmid 3	11095-11124	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135256	Enterococcus faecium isolate E7098 plasmid 3	11245-11274	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135490	Enterococcus faecium isolate E8414 plasmid 3	8061-8090	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR134109	Enterococcus faecium isolate E6043 plasmid 5	6272-6301	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	55977-56006	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	98745-98774	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	MN831413	Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence	16748-16777	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	52172-52201	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	60989-61018	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP039730	Enterococcus faecium strain ZY2 plasmid pZY2	2478-2507	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040238	Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence	20569-20598	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	43272-43301	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_MG640601	Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence	8438-8467	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LT598665	Enterococcus faecium isolate Ef_aus00233 plasmid 3	2729-2758	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP025427	Enterococcus faecium strain SC4 plasmid p2, complete sequence	136818-136847	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027511	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence	85396-85425	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	6151-6180	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135199	Enterococcus faecium isolate E6055 plasmid 3	4724-4753	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135180	Enterococcus faecium isolate E0595 plasmid 2	4819-4848	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123904-123933	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135374	Enterococcus faecium isolate E8172 plasmid 3	4724-4753	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR132068	Enterococcus faecium isolate E0139 plasmid 2	4819-4848	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041272	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2	78217-78246	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	71708-71737	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	183278-183307	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP037956	Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence	39531-39560	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	90519-90548	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	LR135186	Enterococcus faecium isolate E4413 genome assembly, plasmid: 2	4819-4848	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP025427	Enterococcus faecium strain SC4 plasmid p2, complete sequence	136752-136781	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP041263	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2	11622-11651	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP027511	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence	85330-85359	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135245	Enterococcus faecium isolate E6988 plasmid 3	11161-11190	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135256	Enterococcus faecium isolate E7098 plasmid 3	11311-11340	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135490	Enterococcus faecium isolate E8414 plasmid 3	8127-8156	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123772-123801	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123838-123867	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR134109	Enterococcus faecium isolate E6043 plasmid 5	6338-6367	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP041272	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2	78151-78180	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP039730	Enterococcus faecium strain ZY2 plasmid pZY2	2544-2573	0	1.0
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_MG640601	Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence	8504-8533	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041263	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2	11554-11580	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135245	Enterococcus faecium isolate E6988 plasmid 3	11093-11119	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135256	Enterococcus faecium isolate E7098 plasmid 3	11243-11269	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135490	Enterococcus faecium isolate E8414 plasmid 3	8059-8085	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR134109	Enterococcus faecium isolate E6043 plasmid 5	6270-6296	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	MN831413	Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence	16746-16772	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP039730	Enterococcus faecium strain ZY2 plasmid pZY2	2476-2502	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040238	Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence	20567-20593	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_MG640601	Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence	8436-8462	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LT598665	Enterococcus faecium isolate Ef_aus00233 plasmid 3	2727-2753	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP025427	Enterococcus faecium strain SC4 plasmid p2, complete sequence	136823-136849	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027511	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence	85401-85427	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123909-123935	0	1.0
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041272	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2	78222-78248	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP025427	Enterococcus faecium strain SC4 plasmid p2, complete sequence	136753-136781	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP027511	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence	85331-85359	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123773-123801	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP044266	Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence	123839-123867	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP041272	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2	78152-78180	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP041263	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2	11622-11650	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135245	Enterococcus faecium isolate E6988 plasmid 3	11161-11189	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135256	Enterococcus faecium isolate E7098 plasmid 3	11311-11339	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135490	Enterococcus faecium isolate E8414 plasmid 3	8127-8155	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR134109	Enterococcus faecium isolate E6043 plasmid 5	6338-6366	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP039730	Enterococcus faecium strain ZY2 plasmid pZY2	2544-2572	0	1.0
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_MG640601	Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence	8504-8532	0	1.0
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040906	Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence	46726-46755	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	104418-104447	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP012385	Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence	90078-90107	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	287701-287730	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	115579-115608	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018070	Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence	12157-12186	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018070	Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence	75629-75658	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135280	Enterococcus faecium isolate E6975 plasmid 3	47725-47754	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135477	Enterococcus faecium isolate E8423 plasmid 3	6959-6988	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	86388-86417	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	97412-97441	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP015517	Enterococcus hirae strain R17 plasmid, complete sequence	8507-8536	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	92662-92691	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	47623-47652	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	29112-29141	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	35530-35559	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP019974	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence	44725-44754	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	11096-11125	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP012463	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence	43131-43160	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	164278-164307	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP011283	Enterococcus faecium strain E39 plasmid p2, complete sequence	6434-6463	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP015123	Enterococcus faecium strain E39 plasmid p3, complete sequence	6754-6783	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_KP342511	Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence	20782-20811	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	LT603680	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3	4724-4753	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	15130-15159	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	CP003352	Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	4836-4865	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041264	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence	8493-8522	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP012367	Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence	8376-8405	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027499	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	4836-4865	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135289	Enterococcus faecium isolate E7199 plasmid 3	12894-12923	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	4368-4397	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	157892-157921	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	4447-4476	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP013010	Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence	62592-62621	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	6259-6288	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	4447-4476	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135257	Enterococcus faecium isolate E7098 plasmid 4	8492-8521	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	7114-7143	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041254	Enterococcus faecium strain 515 plasmid p169, complete sequence	59573-59602	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NC_021995	Enterococcus faecium Aus0085 plasmid p2, complete sequence	6705-6734	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP017799	Enterococcus faecium strain E243 plasmid unnamed2, complete sequence	6754-6783	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	4368-4397	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	5434-5463	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	6151-6180	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	4447-4476	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135207	Enterococcus faecium isolate E7171 plasmid 5	4724-4753	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	5492-5521	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135228	Enterococcus faecium isolate E7025 plasmid 3	4724-4753	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	8774-8803	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135221	Enterococcus faecium isolate E7040 plasmid 3	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135326	Enterococcus faecium isolate E7654 plasmid 3	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	4836-4865	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135319	Enterococcus faecium isolate E7663 plasmid 3	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	6338-6367	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	6420-6449	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	4368-4397	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP045013	Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence	4368-4397	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	206632-206661	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	6151-6180	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023425	Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence	8492-8521	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041273	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence	8492-8521	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040873	Enterococcus faecium strain DB-1 plasmid punnamed1	45021-45050	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040876	Enterococcus faecium strain DB-1 plasmid punnamed2	7871-7900	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	7707-7736	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP017794	Enterococcus faecium strain E240 plasmid unnamed2, complete sequence	6727-6756	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	5492-5521	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	6259-6288	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	5434-5463	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	4835-4864	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP019971	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence	118208-118237	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135309	Enterococcus faecium isolate E7240 plasmid 3	40225-40254	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	4836-4865	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	1645-1674	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023812	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence	6709-6738	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP033208	Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence	4725-4754	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	65568-65597	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	9108-9137	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	15130-15159	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	29948-29977	1	0.967
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LT598666	Enterococcus faecium isolate Ef_aus00233 plasmid 4	6709-6738	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP020486	Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence	1020-1049	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP027519	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence	18673-18702	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135300	Enterococcus faecium isolate E7429 plasmid 4	10919-10948	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135342	Enterococcus faecium isolate E7356 plasmid 4	28089-28118	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135295	Enterococcus faecium isolate E7237 plasmid 3	4028-4057	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NC_010880	Enterococcus faecium plasmid pEF1, complete sequence	14006-14035	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135491	Enterococcus faecium isolate E8414 plasmid 4	27218-27247	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135366	Enterococcus faecium isolate E8195 plasmid 3	20506-20535	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135403	Enterococcus faecium isolate E8377 plasmid 3	8916-8945	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135396	Enterococcus faecium isolate E8290 plasmid 3	54027-54056	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135346	Enterococcus faecium isolate E8202 plasmid 3	16823-16852	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135353	Enterococcus faecium isolate E8014 plasmid 3	32700-32729	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR135387	Enterococcus faecium isolate E7933 plasmid 4	27113-27142	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_LR134110	Enterococcus faecium isolate E6043 plasmid 6	8200-8229	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP044276	Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence	9617-9646	1	0.967
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP018067	Enterococcus faecium strain E1 plasmid pE1_29, complete sequence	7321-7350	1	0.967
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	55975-56001	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	98743-98769	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	52170-52196	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	60987-61013	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	43270-43296	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	6156-6182	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135199	Enterococcus faecium isolate E6055 plasmid 3	4729-4755	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135180	Enterococcus faecium isolate E0595 plasmid 2	4824-4850	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135374	Enterococcus faecium isolate E8172 plasmid 3	4729-4755	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR132068	Enterococcus faecium isolate E0139 plasmid 2	4824-4850	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	71713-71739	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	183283-183309	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP037956	Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence	39536-39562	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	90524-90550	1	0.963
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	LR135186	Enterococcus faecium isolate E4413 genome assembly, plasmid: 2	4824-4850	1	0.963
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP020486	Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence	1021-1049	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP027519	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence	18674-18702	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135342	Enterococcus faecium isolate E7356 plasmid 4	28090-28118	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135295	Enterococcus faecium isolate E7237 plasmid 3	4029-4057	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NC_010880	Enterococcus faecium plasmid pEF1, complete sequence	14007-14035	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135346	Enterococcus faecium isolate E8202 plasmid 3	16824-16852	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135353	Enterococcus faecium isolate E8014 plasmid 3	32701-32729	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR134110	Enterococcus faecium isolate E6043 plasmid 6	8201-8229	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP018067	Enterococcus faecium strain E1 plasmid pE1_29, complete sequence	7322-7350	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135300	Enterococcus faecium isolate E7429 plasmid 4	10919-10947	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135491	Enterococcus faecium isolate E8414 plasmid 4	27218-27246	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135366	Enterococcus faecium isolate E8195 plasmid 3	20506-20534	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135403	Enterococcus faecium isolate E8377 plasmid 3	8916-8944	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135396	Enterococcus faecium isolate E8290 plasmid 3	54027-54055	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_LR135387	Enterococcus faecium isolate E7933 plasmid 4	27113-27141	1	0.966
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP044276	Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence	9617-9645	1	0.966
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	352516-352545	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	215527-215556	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135246	Enterococcus faecium isolate E6988 plasmid 4	6851-6880	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135237	Enterococcus faecium isolate E7067 plasmid 3	5683-5712	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135261	Enterococcus faecium isolate E4457 plasmid 4	37696-37725	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP041258	Enterococcus faecium strain 515 plasmid p27, complete sequence	75811-75840	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135222	Enterococcus faecium isolate E7040 plasmid 4	48704-48733	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR134108	Enterococcus faecium isolate E6043 plasmid 4	42202-42231	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	102245-102274	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027508	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence	4743-4772	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027503	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence	4744-4773	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP027514	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence	4744-4773	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135238	Enterococcus faecium isolate E7067 plasmid 4	4725-4754	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135205	Enterococcus faecium isolate E7171 plasmid 3	30099-30128	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	7707-7736	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135386	Enterococcus faecium isolate E7933 plasmid 3	10383-10412	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	23844-23873	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	10087-10116	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	6150-6179	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	6150-6179	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	6150-6179	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	6151-6180	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_LR135193	Enterococcus faecium isolate E4438 plasmid 3	4724-4753	2	0.933
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP012432	Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence	37702-37731	2	0.933
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	215525-215551	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040906	Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence	46724-46750	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	104416-104442	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP012385	Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence	90076-90102	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	287699-287725	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	352514-352540	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	115577-115603	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018070	Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence	12155-12181	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018070	Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence	75627-75653	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135246	Enterococcus faecium isolate E6988 plasmid 4	6849-6875	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135280	Enterococcus faecium isolate E6975 plasmid 3	47723-47749	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135237	Enterococcus faecium isolate E7067 plasmid 3	5681-5707	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135261	Enterococcus faecium isolate E4457 plasmid 4	37694-37720	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041258	Enterococcus faecium strain 515 plasmid p27, complete sequence	75809-75835	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135477	Enterococcus faecium isolate E8423 plasmid 3	6957-6983	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135222	Enterococcus faecium isolate E7040 plasmid 4	48702-48728	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	86386-86412	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	97410-97436	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR134108	Enterococcus faecium isolate E6043 plasmid 4	42200-42226	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP015517	Enterococcus hirae strain R17 plasmid, complete sequence	8505-8531	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	92660-92686	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	47621-47647	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	29110-29136	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	35528-35554	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP019974	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence	44723-44749	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	11094-11120	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP012463	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence	43129-43155	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	164276-164302	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP011283	Enterococcus faecium strain E39 plasmid p2, complete sequence	6439-6465	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP015123	Enterococcus faecium strain E39 plasmid p3, complete sequence	6759-6785	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_KP342511	Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence	20787-20813	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	LT603680	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3	4729-4755	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	15135-15161	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	CP003352	Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	102250-102276	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	4841-4867	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041264	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence	8498-8524	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP012367	Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence	8381-8407	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027499	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027508	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence	4748-4774	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	4841-4867	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027503	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence	4749-4775	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135289	Enterococcus faecium isolate E7199 plasmid 3	12899-12925	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	4373-4399	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	157897-157923	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	4452-4478	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP027514	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence	4749-4775	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP013010	Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence	62597-62623	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	6264-6290	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	4452-4478	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135257	Enterococcus faecium isolate E7098 plasmid 4	8497-8523	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135238	Enterococcus faecium isolate E7067 plasmid 4	4730-4756	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	7119-7145	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041254	Enterococcus faecium strain 515 plasmid p169, complete sequence	59578-59604	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NC_021995	Enterococcus faecium Aus0085 plasmid p2, complete sequence	6710-6736	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP017799	Enterococcus faecium strain E243 plasmid unnamed2, complete sequence	6759-6785	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	4373-4399	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	5439-5465	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	4452-4478	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135207	Enterococcus faecium isolate E7171 plasmid 5	4729-4755	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	5497-5523	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135228	Enterococcus faecium isolate E7025 plasmid 3	4729-4755	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	8779-8805	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135221	Enterococcus faecium isolate E7040 plasmid 3	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135326	Enterococcus faecium isolate E7654 plasmid 3	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135386	Enterococcus faecium isolate E7933 plasmid 3	10388-10414	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	4841-4867	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135319	Enterococcus faecium isolate E7663 plasmid 3	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	6343-6369	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	6425-6451	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	4373-4399	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP045013	Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence	4373-4399	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	206637-206663	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP014534	Enterococcus faecium strain E745 plasmid pl5, complete sequence	23849-23875	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023425	Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence	8497-8523	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	10092-10118	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041273	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence	8497-8523	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040873	Enterococcus faecium strain DB-1 plasmid punnamed1	45026-45052	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040876	Enterococcus faecium strain DB-1 plasmid punnamed2	7876-7902	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	7712-7738	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP017794	Enterococcus faecium strain E240 plasmid unnamed2, complete sequence	6732-6758	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	6155-6181	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	6155-6181	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	6155-6181	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	5497-5523	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	6156-6182	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	6264-6290	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	5439-5465	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135193	Enterococcus faecium isolate E4438 plasmid 3	4729-4755	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	4840-4866	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP019971	Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence	118213-118239	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135309	Enterococcus faecium isolate E7240 plasmid 3	40230-40256	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	4841-4867	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	1650-1676	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023812	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence	6714-6740	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP033208	Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence	4730-4756	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	65573-65599	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	9113-9139	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	15135-15161	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP012432	Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence	37707-37733	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	29953-29979	2	0.926
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LT598666	Enterococcus faecium isolate Ef_aus00233 plasmid 4	6714-6740	2	0.926
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP040851	Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence	357-386	3	0.9
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	181272-181301	3	0.9
LR135256_1	1.1|11245|30|LR135256|CRISPRCasFinder	11245-11274	30	NZ_CP016165	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence	50319-50348	3	0.9
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP040851	Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence	355-381	3	0.889
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_LR135205	Enterococcus faecium isolate E7171 plasmid 3	30104-30130	3	0.889
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	181277-181303	3	0.889
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NZ_CP016165	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence	50324-50350	3	0.889
LR135256_1	1.3|11262|27|LR135256|PILER-CR	11262-11288	27	NC_022883	Enterococcus mundtii QU 25 plasmid pQY082, complete sequence	33166-33192	4	0.852
LR135256_1	1.4|11332|29|LR135256|PILER-CR	11332-11360	29	NZ_CP026693	Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence	109882-109910	7	0.759
LR135256_1	1.2|11311|30|LR135256|CRISPRCasFinder	11311-11340	30	NZ_CP026693	Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence	109881-109910	8	0.733

1. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

2. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

3. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

4. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

5. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

6. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

7. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

8. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

9. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

10. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

11. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

12. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

13. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

14. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

15. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

16. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

17. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

18. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

19. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

20. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

21. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

22. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

23. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

24. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

25. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

26. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

27. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

28. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

29. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcaattaatttaaagtactc	Protospacer
******************************

30. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

31. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

32. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

33. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

34. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

35. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

36. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

37. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

38. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

39. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

40. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

41. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaaa	Protospacer
******************************

42. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

43. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

44. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

45. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

46. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

47. spacer 1.3|11262|27|LR135256|PILER-CR matches to MN831413 (Enterococcus faecium strain M17/0314 plasmid pM17/0314, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

48. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

49. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040238 (Enterococcus faecium strain VB3025 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

50. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

51. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598665 (Enterococcus faecium isolate Ef_aus00233 plasmid 3) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

52. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

53. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

54. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

55. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

gcaggaacgccatcaattaatttaaag	CRISPR spacer
gcaggaacgccatcaattaatttaaag	Protospacer
***************************

56. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP025427 (Enterococcus faecium strain SC4 plasmid p2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

57. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP027511 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

58. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

59. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044266 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-2, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

60. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP041272 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

61. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP041263 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

62. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135245 (Enterococcus faecium isolate E6988 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

63. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135256 (Enterococcus faecium isolate E7098 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

64. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135490 (Enterococcus faecium isolate E8414 plasmid 3) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

65. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR134109 (Enterococcus faecium isolate E6043 plasmid 5) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

66. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP039730 (Enterococcus faecium strain ZY2 plasmid pZY2) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

67. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_MG640601 (Enterococcus faecium strain SRR6 plasmid pEMSRR6, complete sequence) position: , mismatch: 0, identity: 1.0

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactgctagcaatttcccttatcctaaa	Protospacer
*****************************

68. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

69. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

70. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

71. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

72. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

73. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

74. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

75. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

76. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

77. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

78. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

79. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

80. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

81. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

82. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

83. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

84. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP019974 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

85. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

86. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

87. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

88. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

89. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

90. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

91. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

92. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

93. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

94. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

95. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

96. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

97. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

98. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

99. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

100. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

101. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

102. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

103. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

104. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

105. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

106. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

107. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

108. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

109. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

110. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

111. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

112. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

113. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

114. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

115. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

116. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

117. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

118. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

119. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

120. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

121. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

122. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

123. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

124. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

125. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

126. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

127. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

128. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

129. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

130. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

131. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

132. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

133. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

134. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

135. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

136. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

137. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

138. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

139. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

140. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

141. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

142. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

143. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

144. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

145. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

146. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

147. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

148. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

149. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

150. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

151. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

152. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

153. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

154. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

155. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

156. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

157. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

158. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

159. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

160. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

161. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

162. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

163. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 1, identity: 0.967

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtactc	Protospacer
************.*****************

164. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP020486 (Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

165. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP027519 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

166. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135300 (Enterococcus faecium isolate E7429 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

167. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135342 (Enterococcus faecium isolate E7356 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

168. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135295 (Enterococcus faecium isolate E7237 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

169. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NC_010880 (Enterococcus faecium plasmid pEF1, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

170. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135491 (Enterococcus faecium isolate E8414 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

171. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135366 (Enterococcus faecium isolate E8195 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

172. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135403 (Enterococcus faecium isolate E8377 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

173. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135396 (Enterococcus faecium isolate E8290 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

174. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135346 (Enterococcus faecium isolate E8202 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

175. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135353 (Enterococcus faecium isolate E8014 plasmid 3) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

176. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR135387 (Enterococcus faecium isolate E7933 plasmid 4) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

177. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_LR134110 (Enterococcus faecium isolate E6043 plasmid 6) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

178. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP044276 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

179. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP018067 (Enterococcus faecium strain E1 plasmid pE1_29, complete sequence) position: , mismatch: 1, identity: 0.967

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaaa	Protospacer
*****.************************

180. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

181. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

182. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

183. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

184. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

185. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

186. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135199 (Enterococcus faecium isolate E6055 plasmid 3) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

187. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

188. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135374 (Enterococcus faecium isolate E8172 plasmid 3) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

189. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

190. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

191. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

192. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

193. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

194. spacer 1.3|11262|27|LR135256|PILER-CR matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 1, identity: 0.963

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcaattaatttaaag	Protospacer
 **************************

195. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP020486 (Enterococcus faecium strain CFSAN059070 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

196. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP027519 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

197. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135342 (Enterococcus faecium isolate E7356 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

198. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135295 (Enterococcus faecium isolate E7237 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

199. spacer 1.4|11332|29|LR135256|PILER-CR matches to NC_010880 (Enterococcus faecium plasmid pEF1, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

200. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135346 (Enterococcus faecium isolate E8202 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

201. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135353 (Enterococcus faecium isolate E8014 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

202. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR134110 (Enterococcus faecium isolate E6043 plasmid 6) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

203. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP018067 (Enterococcus faecium strain E1 plasmid pE1_29, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

204. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135300 (Enterococcus faecium isolate E7429 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

205. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135491 (Enterococcus faecium isolate E8414 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

206. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135366 (Enterococcus faecium isolate E8195 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

207. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135403 (Enterococcus faecium isolate E8377 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

208. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135396 (Enterococcus faecium isolate E8290 plasmid 3) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

209. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_LR135387 (Enterococcus faecium isolate E7933 plasmid 4) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

210. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP044276 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-2, complete sequence) position: , mismatch: 1, identity: 0.966

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactactagcaatttcccttatcctaaa	Protospacer
*****.***********************

211. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

212. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

213. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

214. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

215. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

216. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

217. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

218. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

219. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

220. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

221. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

222. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

223. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

224. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

225. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

226. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacaccattaattaatttaaagtactc	Protospacer
******.****.******************

227. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

228. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

229. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

230. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

231. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

232. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

233. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtgctc	Protospacer
************.*************.***

234. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

235. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

236. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

237. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

238. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

239. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 2, identity: 0.933

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatttaaagtaccc	Protospacer
************.***************.*

240. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

241. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

242. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

243. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

244. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

245. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

246. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

247. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

248. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018070 (Enterococcus faecium strain VRE001 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

249. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135246 (Enterococcus faecium isolate E6988 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

250. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135280 (Enterococcus faecium isolate E6975 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

251. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135237 (Enterococcus faecium isolate E7067 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

252. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135261 (Enterococcus faecium isolate E4457 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

253. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041258 (Enterococcus faecium strain 515 plasmid p27, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

254. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135477 (Enterococcus faecium isolate E8423 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

255. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135222 (Enterococcus faecium isolate E7040 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

256. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

257. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

258. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134108 (Enterococcus faecium isolate E6043 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

259. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP015517 (Enterococcus hirae strain R17 plasmid, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

260. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

261. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

262. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

263. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

264. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP019974 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-4 sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

265. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

266. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012463 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

267. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

268. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP011283 (Enterococcus faecium strain E39 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

269. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP015123 (Enterococcus faecium strain E39 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

270. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_KP342511 (Enterococcus faecium isolate N12-493 plasmid pEfm12493, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

271. spacer 1.3|11262|27|LR135256|PILER-CR matches to LT603680 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

272. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

273. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

274. spacer 1.3|11262|27|LR135256|PILER-CR matches to CP003352 (Enterococcus faecium Aus0004 plasmid AUS0004_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

275. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

276. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

277. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041264 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

278. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

279. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

280. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027499 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

281. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027508 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

282. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

283. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027503 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

284. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

285. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135289 (Enterococcus faecium isolate E7199 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

286. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

287. spacer 1.3|11262|27|LR135256|PILER-CR matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

288. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

289. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

290. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP027514 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

291. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP013010 (Enterococcus faecium strain UW7606x64/3 TC1 plasmid pWCF-TC1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

292. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

293. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

294. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135257 (Enterococcus faecium isolate E7098 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

295. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135238 (Enterococcus faecium isolate E7067 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

296. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

297. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

298. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041254 (Enterococcus faecium strain 515 plasmid p169, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

299. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_021995 (Enterococcus faecium Aus0085 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

300. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP017799 (Enterococcus faecium strain E243 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

301. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

302. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

303. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

304. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

305. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

306. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135207 (Enterococcus faecium isolate E7171 plasmid 5) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

307. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

308. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135228 (Enterococcus faecium isolate E7025 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

309. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

310. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

311. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135221 (Enterococcus faecium isolate E7040 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

312. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

313. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

314. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

315. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135326 (Enterococcus faecium isolate E7654 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

316. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

317. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

318. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

319. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

320. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135386 (Enterococcus faecium isolate E7933 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

321. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

322. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135319 (Enterococcus faecium isolate E7663 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

323. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

324. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

325. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

326. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

327. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

328. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

329. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP014534 (Enterococcus faecium strain E745 plasmid pl5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

330. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

331. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023425 (Enterococcus faecium strain K60-39 plasmid pTT39_p2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

332. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

333. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041273 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S3, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

334. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

335. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

336. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

337. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP017794 (Enterococcus faecium strain E240 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

338. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

339. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

340. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

341. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

342. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

343. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

344. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

345. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

346. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

347. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135193 (Enterococcus faecium isolate E4438 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

348. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

349. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP019971 (Enterococcus faecium isolate 2014-VREF-114 plasmid p114-1 sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

350. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135309 (Enterococcus faecium isolate E7240 plasmid 3) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

351. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

352. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

353. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

354. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023812 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

355. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP033208 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.2, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

356. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

357. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

358. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

359. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

360. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP012432 (Enterococcus faecium strain ISMMS_VRE_1 plasmid ISMMS_VRE_p1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

361. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

362. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

363. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LT598666 (Enterococcus faecium isolate Ef_aus00233 plasmid 4) position: , mismatch: 2, identity: 0.926

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatttaaag	Protospacer
 *************.************

364. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

365. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

366. spacer 1.1|11245|30|LR135256|CRISPRCasFinder matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 3, identity: 0.9

aggaacgccatcaattaatttaaagtactc	CRISPR spacer
aggaacgccatcgattaatctaaagtaccc	Protospacer
************.******.********.*

367. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP040851 (Enterococcus faecium strain F17E0263 plasmid p_unnamned2, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

368. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_LR135205 (Enterococcus faecium isolate E7171 plasmid 3) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacaccattaattaatttaaag	Protospacer
 *******.****.*************

369. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

370. spacer 1.3|11262|27|LR135256|PILER-CR matches to NZ_CP016165 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p2, complete sequence) position: , mismatch: 3, identity: 0.889

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgattaatctaaag	Protospacer
 *************.******.*****

371. spacer 1.3|11262|27|LR135256|PILER-CR matches to NC_022883 (Enterococcus mundtii QU 25 plasmid pQY082, complete sequence) position: , mismatch: 4, identity: 0.852

gcaggaacgccatcaattaatttaaag	CRISPR spacer
tcaggaacgccatcgatcaatttaaaa	Protospacer
 *************.**.********.

372. spacer 1.4|11332|29|LR135256|PILER-CR matches to NZ_CP026693 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence) position: , mismatch: 7, identity: 0.759

aaactgctagcaatttcccttatcctaaa	CRISPR spacer
aaactggtagcaatttcccctatcagtgc	Protospacer
****** ************.****   . 

373. spacer 1.2|11311|30|LR135256|CRISPRCasFinder matches to NZ_CP026693 (Nostoc sp. 'Lobaria pulmonaria (5183) cyanobiont' strain 5183 plasmid pNLP1, complete sequence) position: , mismatch: 8, identity: 0.733

aaactgctagcaatttcccttatcctaaaa	CRISPR spacer
aaactggtagcaatttcccctatcagtgcc	Protospacer
****** ************.****   .  

2. LR135254

CRISPR-Cas detection and classification

Crispr_ID: LR135254_1

• CRISPR_ID: LR135254_1
• CRISPR_location: 2290506-2290615
• CRISPR_type: Orphan
• Repeat_type: NA
• Spacer_info: 1 spacers

Consensus repeat of LR135254_1

Consensus_repeat	Method
CTTTGCTCAACCAGTATTATTCATCA	CRISPRCasFinder

spacers of LR135254_1

>1.1|2290532|58|LR135254|CRISPRCasFinder
CCTATTCACTTCGTTCATAGTGATTCTACTCGCTTTGCTCGAAAGGAAACTCCTTTCG

CRISPR arrays and Neighbor proteins around LR135254_1

CRISPR arrays

The CRISPR arrays of LR135254_1

>merge|LR135254|1|2290506-2290615|CRISPRCasFinder
CTTTGCTCAACCAGTATTATTCATCACCTATTCACTTCGTTCATAGTGATTCTACTCGCTTTGCTCGAAAGGAAACTCCTTTCGCTTTGCTCAACCAGTATTGTTCATCA

>LR135254|1|1|2290506-2290615|CRISPRCasFinder
CTTTGCTCAACCAGTATTATTCATCA	CCTATTCACTTCGTTCATAGTGATTCTACTCGCTTTGCTCGAAAGGAAACTCCTTTCG
CTTTGCTCAACCAGTATTGTTCATCA

Protein sequences

3. LR135257

4. LR135255

CRISPR-Cas detection and classification

Crispr_ID: LR135255_1

• CRISPR_ID: LR135255_1
• CRISPR_location: 430-557
• CRISPR_type: Orphan
• Repeat_type: NA
• Spacer_info: 2 spacers

Consensus repeat of LR135255_1

Consensus_repeat	Method
TCAGAGGGTATGAAAATCATACC	CRISPRCasFinder

spacers of LR135255_1

>1.1|453|40|LR135255|CRISPRCasFinder
CACCCTCGACGAAAAATCAGACGCTGAATCCCTTGGGGCT
>1.2|516|19|LR135255|CRISPRCasFinder
GTGCCAAAACGTTGATAAA

CRISPR arrays and Neighbor proteins around LR135255_1

CRISPR arrays

The CRISPR arrays of LR135255_1

>merge|LR135255|1|430-557|CRISPRCasFinder
TCAGAGGGTATGAAAATCATACCCACCCTCGACGAAAAATCAGACGCTGAATCCCTTGGGGCTCAAGAGGGTATGAAAATCATACCGTGCCAAAACGTTGATAAATCAGAGGGTATGAAAATCATACC

>LR135255|1|1|430-557|CRISPRCasFinder
TCAGAGGGTATGAAAATCATACC	CACCCTCGACGAAAAATCAGACGCTGAATCCCTTGGGGCT
CAAGAGGGTATGAAAATCATACC	GTGCCAAAACGTTGATAAA
TCAGAGGGTATGAAAATCATACC

Protein sequences

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP011282	Enterococcus faecium strain E39 plasmid p1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	221215-221254	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	LT603679	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2	452-491	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	244126-244165	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP043485	Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence	27883-27922	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	96547-96586	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	454-493	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP012385	Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence	95091-95130	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	358204-358243	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	119936-119975	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP018073	Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence	111370-111409	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135288	Enterococcus faecium isolate E7199 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135333	Enterococcus faecium isolate E7471 plasmid 3	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	126934-126973	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135244	Enterococcus faecium isolate E6988 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135279	Enterococcus faecium isolate E6975 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135255	Enterococcus faecium isolate E7098 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135236	Enterococcus faecium isolate E7067 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135182	Enterococcus faecium isolate E1774 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040905	Enterococcus faecium strain N56454 plasmid unnamed, complete sequence	153620-153659	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP041256	Enterococcus faecium strain 515 plasmid p26, complete sequence	129211-129250	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	71269-71308	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	249117-249156	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP017798	Enterococcus faecium strain E243 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135180	Enterococcus faecium isolate E0595 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135227	Enterococcus faecium isolate E7025 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135220	Enterococcus faecium isolate E7040 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NC_021987	Enterococcus faecium Aus0085 plasmid p1, complete sequence	107198-107237	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135325	Enterococcus faecium isolate E7654 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	91401-91440	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	102425-102464	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135318	Enterococcus faecium isolate E7663 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR134106	Enterococcus faecium isolate E6043 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	1397-1436	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	60361-60400	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR132068	Enterococcus faecium isolate E0139 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	97676-97715	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	52636-52675	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	102650-102689	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	200630-200669	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	56542-56581	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	65332-65371	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	67328-67367	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP017793	Enterococcus faecium strain E240 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	14571-14610	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	178898-178937	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	33081-33120	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	105709-105748	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	39886-39925	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP037956	Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence	35165-35204	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135308	Enterococcus faecium isolate E7240 plasmid 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	225612-225651	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP033207	Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence	92045-92084	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	17088-17127	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	86167-86206	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_AP019409	Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	61653-61692	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	5084-5123	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	177278-177317	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	244126-244165	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	LR135186	Enterococcus faecium isolate E4413 genome assembly, plasmid: 2	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	192112-192151	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_MG674581	Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	453-492	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	168262-168301	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP025426	Enterococcus faecium strain SC4 plasmid p1, complete sequence	221173-221191	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040906	Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence	51712-51730	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	109405-109423	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP013995	Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence	358162-358180	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP014450	Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence	119894-119912	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040905	Enterococcus faecium strain N56454 plasmid unnamed, complete sequence	153578-153596	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP041256	Enterococcus faecium strain 515 plasmid p26, complete sequence	129169-129187	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	249075-249093	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP050649	Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE	91359-91377	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP050651	Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT	102383-102401	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP011829	Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence	60319-60337	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LN999988	Enterococcus faecium isolate EFE11651 plasmid II, complete sequence	97634-97652	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP033042	Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence	52594-52612	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP025687	Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence	102608-102626	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040877	Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence	56500-56518	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP032307	Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence	65290-65308	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP019993	Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence	14529-14547	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NC_017963	Enterococcus faecium DO plasmid 3, complete sequence	33039-33057	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP042840	Enterococcus sp. DA9 plasmid unnamed4	39844-39862	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP033207	Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence	92003-92021	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP018129	Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence	17046-17064	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	47586-47604	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP012461	Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence	192070-192088	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LT598664	Enterococcus faecium isolate Ef_aus00233 plasmid 2	168220-168238	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP011282	Enterococcus faecium strain E39 plasmid p1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	LT603679	Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2	515-533	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	244189-244207	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040369	Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP043485	Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence	27946-27964	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP020485	Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence	96610-96628	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP041262	Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence	517-535	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP018073	Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence	111433-111451	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027518	Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027498	Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027507	Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027502	Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135298	Enterococcus faecium isolate E7429 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135288	Enterococcus faecium isolate E7199 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135333	Enterococcus faecium isolate E7471 plasmid 3	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135340	Enterococcus faecium isolate E7356 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP046076	Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	MT074686	Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP025756	Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence	126997-127015	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP027513	Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135244	Enterococcus faecium isolate E6988 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135279	Enterococcus faecium isolate E6975 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135783	Enterococcus faecium isolate E4239 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135294	Enterococcus faecium isolate E7237 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135255	Enterococcus faecium isolate E7098 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135236	Enterococcus faecium isolate E7067 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135198	Enterococcus faecium isolate E6055 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135259	Enterococcus faecium isolate E4457 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135182	Enterococcus faecium isolate E1774 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP019209	Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence	71332-71350	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP017798	Enterococcus faecium strain E243 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135429	Enterococcus faecium isolate E8927 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135436	Enterococcus faecium isolate E8691 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135483	Enterococcus faecium isolate E4456 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135476	Enterococcus faecium isolate E8423 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135204	Enterococcus faecium isolate E7171 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135227	Enterococcus faecium isolate E7025 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135489	Enterococcus faecium isolate E8414 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135365	Enterococcus faecium isolate E8195 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135220	Enterococcus faecium isolate E7040 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135415	Enterococcus faecium isolate E8328 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135395	Enterococcus faecium isolate E8290 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NC_021987	Enterococcus faecium Aus0085 plasmid p1, complete sequence	107261-107279	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135345	Enterococcus faecium isolate E8202 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135325	Enterococcus faecium isolate E7654 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135358	Enterococcus faecium isolate E7948 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135409	Enterococcus faecium isolate E8284 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135352	Enterococcus faecium isolate E8014 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135385	Enterococcus faecium isolate E7933 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP044265	Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135318	Enterococcus faecium isolate E7663 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR134106	Enterococcus faecium isolate E6043 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135373	Enterococcus faecium isolate E8172 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP006031	Enterococcus faecium T110 plasmid pEFT110, complete sequence	1460-1478	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_AP019395	Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP045013	Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040741	Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP014530	Enterococcus faecium strain E745 plasmid pl1, complete sequence	200693-200711	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023424	Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_AP022342	Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040704	Enterococcus faecium strain HOU503 plasmid p1, complete sequence	67391-67409	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040873	Enterococcus faecium strain DB-1 plasmid punnamed1	40046-40064	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040876	Enterococcus faecium strain DB-1 plasmid punnamed2	2896-2914	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP044275	Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP017793	Enterococcus faecium strain E240 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035655	Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023790	Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023800	Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035137	Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence	178961-178979	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035661	Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035667	Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035649	Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040850	Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence	105772-105790	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135171	Enterococcus faecium isolate E4227 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135192	Enterococcus faecium isolate E4438 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP041271	Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_LR135308	Enterococcus faecium isolate E7240 plasmid 2	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP040237	Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP018066	Enterococcus faecium strain E1 plasmid pE1_230, complete sequence	225675-225693	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023809	Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023805	Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP035221	Enterococcus faecium strain SRCM103470 plasmid unnamed1	86230-86248	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_AP019409	Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NC_020208	Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence	61716-61734	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP034948	Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence	5147-5165	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP016164	Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence	177341-177359	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP018827	Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence	244189-244207	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023795	Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_MG674581	Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence	516-534	0	1.0
LR135255_1	1.2|516|19|LR135255|CRISPRCasFinder	516-534	19	NZ_CP023781	Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence	516-534	0	1.0
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP027401	Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence	109447-109486	1	0.975
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR135175	Enterococcus faecium isolate E4402 plasmid 2	453-492	1	0.975
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_LR134096	Enterococcus faecium isolate E1334 plasmid 2	453-492	1	0.975
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP042833	Enterococcus faecium strain FA3 plasmid unnamed1	47628-47667	1	0.975
LR135255_1	1.1|453|40|LR135255|CRISPRCasFinder	453-492	40	NZ_CP012367	Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence	3358-3397	5	0.875

1. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

2. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

3. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

4. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

5. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

6. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

7. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

8. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

9. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012385 (Enterococcus durans strain KLDS 6.0930 plasmid unnamed 1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

10. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

11. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

12. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

13. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

14. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

15. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

16. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

17. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

18. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

19. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

20. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

21. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

22. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

23. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

24. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

25. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

26. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

27. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

28. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

29. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

30. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

31. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

32. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

33. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

34. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

35. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

36. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

37. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

38. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

39. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

40. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

41. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

42. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

43. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

44. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135180 (Enterococcus faecium isolate E0595 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

45. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

46. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

47. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

48. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

49. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

50. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

51. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

52. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

53. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

54. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

55. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

56. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

57. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

58. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

59. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

60. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

61. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

62. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

63. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

64. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

65. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

66. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR132068 (Enterococcus faecium isolate E0139 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

67. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

68. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

69. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

70. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

71. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

72. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

73. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

74. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

75. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

76. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

77. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

78. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

79. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

80. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

81. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

82. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

83. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

84. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

85. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

86. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

87. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

88. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

89. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

90. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

91. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

92. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

93. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

94. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP037956 (Enterococcus hirae strain CQP3-9 plasmid pCQP3-9_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

95. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

96. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

97. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

98. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

99. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

100. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

101. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

102. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

103. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

104. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

105. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

106. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

107. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

108. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to LR135186 (Enterococcus faecium isolate E4413 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

109. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

110. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

111. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

112. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

113. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
****************************************

114. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025426 (Enterococcus faecium strain SC4 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

115. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040906 (Enterococcus faecium strain FB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

116. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

117. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP013995 (Enterococcus faecium strain 6E6 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

118. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP014450 (Enterococcus faecium strain ATCC 700221 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

119. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040905 (Enterococcus faecium strain N56454 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

120. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041256 (Enterococcus faecium strain 515 plasmid p26, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

121. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019989 (Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

122. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP050649 (Enterococcus faecium strain BIOPOP-3 ALE plasmid pBIOPOP-3_ALE) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

123. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP050651 (Enterococcus faecium strain BIOPOP-3 WT plasmid pBIOPOP-3_WT) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

124. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP011829 (Enterococcus faecium strain UW8175 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

125. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LN999988 (Enterococcus faecium isolate EFE11651 plasmid II, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

126. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP033042 (Enterococcus faecium strain Enterococcus faecium JE1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

127. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025687 (Enterococcus faecium strain CBA7134 plasmid pCBA710401, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

128. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040877 (Enterococcus faecium strain HB-1 plasmid punnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

129. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

130. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019993 (Enterococcus faecium isolate 2014-VREF-268 plasmid p268-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

131. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_017963 (Enterococcus faecium DO plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

132. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP042840 (Enterococcus sp. DA9 plasmid unnamed4) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

133. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP033207 (Enterococcus faecium strain RBWH1 plasmid pRBWH1.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

134. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018129 (Enterococcus faecium strain A_020709_82 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

135. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

136. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP012461 (Enterococcus faecium strain ISMMS_VRE_7 plasmid ISMMS_VRE7_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

137. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LT598664 (Enterococcus faecium isolate Ef_aus00233 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

138. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP011282 (Enterococcus faecium strain E39 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

139. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to LT603679 (Enterococcus faecium isolate Ef_DMG1500501 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

140. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018832 (Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

141. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040369 (Enterococcus faecium strain VB3240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

142. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP043485 (Enterococcus faecium strain DMEA02 plasmid pDMEA1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

143. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP020485 (Enterococcus faecium strain CFSAN059070 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

144. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041262 (Enterococcus faecium strain VVEswe-R plasmid pVVEswe-R1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

145. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018073 (Enterococcus faecium strain VRE001 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

146. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027518 (Enterococcus faecium strain AUSMDU00004024 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

147. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027498 (Enterococcus faecium strain AUSMDU00004167 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

148. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027507 (Enterococcus faecium strain AUSMDU00004055 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

149. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027502 (Enterococcus faecium strain AUSMDU00004142 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

150. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135298 (Enterococcus faecium isolate E7429 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

151. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135288 (Enterococcus faecium isolate E7199 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

152. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135333 (Enterococcus faecium isolate E7471 plasmid 3) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

153. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135340 (Enterococcus faecium isolate E7356 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

154. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP046076 (Enterococcus faecium strain VRE plasmid p5_03A17012, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

155. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to MT074686 (Enterococcus faecium strain E1077 plasmid pE1077-217, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

156. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP025756 (Enterococcus faecium strain AALTL plasmid pEFA-99d7, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

157. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP027513 (Enterococcus faecium strain AUSMDU00004028 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

158. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135244 (Enterococcus faecium isolate E6988 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

159. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135279 (Enterococcus faecium isolate E6975 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

160. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135783 (Enterococcus faecium isolate E4239 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

161. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135294 (Enterococcus faecium isolate E7237 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

162. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135255 (Enterococcus faecium isolate E7098 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

163. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135236 (Enterococcus faecium isolate E7067 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

164. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135198 (Enterococcus faecium isolate E6055 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

165. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135259 (Enterococcus faecium isolate E4457 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

166. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135182 (Enterococcus faecium isolate E1774 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

167. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP019209 (Enterococcus faecium strain 2014-VREF-41 plasmid p41-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

168. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP017798 (Enterococcus faecium strain E243 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

169. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135429 (Enterococcus faecium isolate E8927 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

170. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135436 (Enterococcus faecium isolate E8691 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

171. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135483 (Enterococcus faecium isolate E4456 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

172. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135476 (Enterococcus faecium isolate E8423 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

173. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135204 (Enterococcus faecium isolate E7171 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

174. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

175. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135227 (Enterococcus faecium isolate E7025 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

176. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135489 (Enterococcus faecium isolate E8414 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

177. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135365 (Enterococcus faecium isolate E8195 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

178. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135220 (Enterococcus faecium isolate E7040 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

179. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135415 (Enterococcus faecium isolate E8328 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

180. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135395 (Enterococcus faecium isolate E8290 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

181. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_021987 (Enterococcus faecium Aus0085 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

182. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135345 (Enterococcus faecium isolate E8202 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

183. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135325 (Enterococcus faecium isolate E7654 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

184. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135358 (Enterococcus faecium isolate E7948 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

185. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135409 (Enterococcus faecium isolate E8284 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

186. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135352 (Enterococcus faecium isolate E8014 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

187. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135385 (Enterococcus faecium isolate E7933 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

188. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP044265 (Enterococcus faecium strain V1836 plasmid pHVH-V1836-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

189. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135318 (Enterococcus faecium isolate E7663 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

190. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR134106 (Enterococcus faecium isolate E6043 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

191. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135373 (Enterococcus faecium isolate E8172 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

192. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP006031 (Enterococcus faecium T110 plasmid pEFT110, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

193. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP019395 (Enterococcus faecium strain QU 50 plasmid pQL50, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

194. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP045013 (Enterococcus faecium strain LAC7.2 plasmid pI, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

195. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040741 (Enterococcus faecium strain VRE1 plasmid pVRE1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

196. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP014530 (Enterococcus faecium strain E745 plasmid pl1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

197. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023424 (Enterococcus faecium strain K60-39 plasmid pTT39_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

198. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

199. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040704 (Enterococcus faecium strain HOU503 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

200. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040873 (Enterococcus faecium strain DB-1 plasmid punnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

201. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040876 (Enterococcus faecium strain DB-1 plasmid punnamed2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

202. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP044275 (Enterococcus faecium strain V2937 plasmid pHVH-V2937-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

203. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP017793 (Enterococcus faecium strain E240 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

204. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035655 (Enterococcus faecium strain UAMSEF_08 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

205. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023790 (Enterococcus faecium strain Efaecium_ER04462.3A plasmid pER04462.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

206. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023800 (Enterococcus faecium strain Efaecium_ER04526.5A plasmid pER04526.5A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

207. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035137 (Enterococcus faecium strain SRCM103341 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

208. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035661 (Enterococcus faecium strain UAMSEF_09 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

209. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035667 (Enterococcus faecium strain UAMSEF_20 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

210. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

211. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035649 (Enterococcus faecium strain UAMSEF_01 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

212. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040850 (Enterococcus faecium strain F17E0263 plasmid p_unnamned1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

213. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135171 (Enterococcus faecium isolate E4227 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

214. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135192 (Enterococcus faecium isolate E4438 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

215. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP041271 (Enterococcus faecium strain VVEswe-S plasmid pVVEswe-S1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

216. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_LR135308 (Enterococcus faecium isolate E7240 plasmid 2) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

217. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP040237 (Enterococcus faecium strain VB3025 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

218. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018066 (Enterococcus faecium strain E1 plasmid pE1_230, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

219. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023809 (Enterococcus faecium strain Efaecium_ER04526.3A plasmid pER04562.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

220. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023805 (Enterococcus faecium strain Efaecium_ER04619.3A isolate isolate plasmid pER04619.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

221. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP035221 (Enterococcus faecium strain SRCM103470 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

222. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_AP019409 (Enterococcus faecium strain SMVRE20 plasmid pSMVRE20L, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

223. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NC_020208 (Enterococcus faecium ATCC 8459 = NRRL B-2354 plasmid pNB2354_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

224. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP034948 (Enterococcus faecium strain NM213 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

225. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP016164 (Enterococcus faecium strain ISMMS_VRE_11 plasmid ISMMS_VRE11_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

226. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP018827 (Enterococcus faecium strain ISMMS_VRE_12 plasmid p1_ISMMS_VRE12, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

227. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023795 (Enterococcus faecium strain Efaecium_ER04484.3A plasmid pER04484.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

228. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

229. spacer 1.2|516|19|LR135255|CRISPRCasFinder matches to NZ_CP023781 (Enterococcus faecium strain Efaecium_ER03933.3A isolate isolate plasmid pER93933.3A.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtgccaaaacgttgataaa	CRISPR spacer
gtgccaaaacgttgataaa	Protospacer
*******************

230. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP027401 (Enterococcus faecium strain FDAARGOS_323 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

231. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR135175 (Enterococcus faecium isolate E4402 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

232. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_LR134096 (Enterococcus faecium isolate E1334 plasmid 2) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcaggcgctgaatcccttggggct	Protospacer
********************.*******************

233. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP042833 (Enterococcus faecium strain FA3 plasmid unnamed1) position: , mismatch: 1, identity: 0.975

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
catcctcgacgaaaaatcagacgctgaatcccttggggct	Protospacer
**.*************************************

234. spacer 1.1|453|40|LR135255|CRISPRCasFinder matches to NZ_CP012367 (Enterococcus durans strain KLDS 6.0933 plasmid unnamed 1, complete sequence) position: , mismatch: 5, identity: 0.875

caccctcgacgaaaaatcagacgctgaatcccttggggct	CRISPR spacer
caccctcgacgaaaaatcagacgctgaatccttggggctc	Protospacer
*******************************.* *** ..