1. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP033120 (Acinetobacter wuhouensis strain WCHAW010062 plasmid p11_010062, complete sequence) position: , mismatch: 4, identity: 0.857
ttacgaagttaaaaataatat--attgcca CRISPR spacer
ttactaagttaaaaataatatcaatttc-- Protospacer
**** **************** *** *
2. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP012975 (Staphylococcus aureus strain ST20130943 plasmid pST20130943, complete sequence) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
atacgaagttaaaaaaaatatatgactc Protospacer
************** ******* .*.
3. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP047853 (Staphylococcus aureus strain UP_274 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
atacgaagttaaaaaaaatatatgactc Protospacer
************** ******* .*.
4. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NZ_CP047836 (Staphylococcus aureus strain UP_883 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
atacgaagttaaaaaaaatatatgactc Protospacer
************** ******* .*.
5. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_013550 (Staphylococcus aureus plasmid pBORa53, complete sequence) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
atacgaagttaaaaaaaatatatgactc Protospacer
************** ******* .*.
6. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to AP013412 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G16, isolate: uvMED-CGR-C10A-MedDCM-OCT-S46-C61) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
caggggagttaaaaataatataatgcca Protospacer
. . *.**************** *****
7. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
ttacaaagttagaaataatatatataaa Protospacer
****.******.*********** *
8. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 6, identity: 0.786
ttacgaagttaaaaataatatattgcca CRISPR spacer
gtacgaagataaaaattatatatttcat Protospacer
******* ******* ******* *
9. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to LC377538 (Staphylococcus aureus plasmid pNTUH_3874 NTUH_3874 DNA, complete sequence) position: , mismatch: 7, identity: 0.75
ttacgaagttaaaaataatatattgcca CRISPR spacer
gtacgaagttaacaataatattttagtt Protospacer
*********** ******** **. .
10. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 7, identity: 0.75
ttacgaagttaaaaataatatattgcca CRISPR spacer
cttcgaagttaaaattaatatattttgt Protospacer
.* *********** ********* .
11. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to MK327941 (Escherichia phage vB_EcoM_G37-3, complete genome) position: , mismatch: 7, identity: 0.75
ttacgaagttaaaaataatatattgcca CRISPR spacer
ctacgaagttaaaaaaaacatattcttg Protospacer
.************** **.***** ...
12. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_011836 (Clostridium kluyveri NBRC 12016 plasmid pCKL1, complete sequence) position: , mismatch: 8, identity: 0.714
ttacgaagttaaaaataatatattgcca CRISPR spacer
aggcgaagttaaaaataatatatgtgag Protospacer
.******************** .
13. spacer 1.1|240319|28|LR214940|CRISPRCasFinder matches to NC_009466 (Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence) position: , mismatch: 8, identity: 0.714
ttacgaagttaaaaataatatattgcca CRISPR spacer
aggcgaagttaaaaataatatatgtgag Protospacer
.******************** .