Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR214970 Mycoplasma bovigenitalium strain NCTC10122 genome assembly, chromosome: 1 1 crisprs NA 0 3 0 0

Results visualization

1. LR214970
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR214970_2 415217-415332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR214970_3 3.1|420503|51|LR214970|CRISPRCasFinder 420503-420553 51 NZ_LR215000 Mycoplasma conjunctivae strain NCTC10147 plasmid 4 5160-5210 2 0.961
LR214970_5 5.1|715868|25|LR214970|CRISPRCasFinder 715868-715892 25 NC_021067 Vibrio phage helene 12B3 genomic sequence 79969-79993 4 0.84
LR214970_2 2.1|415256|38|LR214970|CRISPRCasFinder 415256-415293 38 NZ_LR215000 Mycoplasma conjunctivae strain NCTC10147 plasmid 4 4855-4892 6 0.842

1. spacer 3.1|420503|51|LR214970|CRISPRCasFinder matches to NZ_LR215000 (Mycoplasma conjunctivae strain NCTC10147 plasmid 4) position: , mismatch: 2, identity: 0.961

ttattgcaaattattgatagaagaccagaagttttagaatatgtttcagat	CRISPR spacer
ttattgcaaattattgatacaaggccagaagttttagaatatgtttcagat	Protospacer
******************* ***.***************************

2. spacer 5.1|715868|25|LR214970|CRISPRCasFinder matches to NC_021067 (Vibrio phage helene 12B3 genomic sequence) position: , mismatch: 4, identity: 0.84

accgcctaaaaaacaaccaataatt	CRISPR spacer
acctcctataaaacaaccaataaaa	Protospacer
*** **** **************  

3. spacer 2.1|415256|38|LR214970|CRISPRCasFinder matches to NZ_LR215000 (Mycoplasma conjunctivae strain NCTC10147 plasmid 4) position: , mismatch: 6, identity: 0.842

ataattttaacataaataaacttatgtttagtaatagt	CRISPR spacer
gatactttaacataaataaacttatgttttctaatagt	Protospacer
.  *.************************  *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage