Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR215007 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 11 0 crisprs NA 0 0 0 0
LR214997 Mycoplasma conjunctivae strain NCTC10147 genome assembly, chromosome: 1 1 crisprs NA 0 0 1 0
LR215005 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 9 0 crisprs NA 0 0 1 0
LR215003 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 7 0 crisprs DEDDh 0 0 3 0
LR214999 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 3 1 crisprs NA 0 1 0 0
LR215006 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 10 0 crisprs NA 0 0 0 0
LR215002 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 6 0 crisprs DEDDh 0 0 0 0
LR214998 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 2 0 crisprs NA 0 0 0 0
LR215000 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 4 0 crisprs NA 0 0 0 0
LR215001 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 5 0 crisprs NA 0 0 0 0
LR215004 Mycoplasma conjunctivae strain NCTC10147 genome assembly, plasmid: 8 0 crisprs NA 0 0 0 0

Results visualization

1. LR214997
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR214997_3 411206-411314 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 731342 : 741009 7 Mycoplasma_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. LR215005
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19649 : 33113 11 Bacillus_phage(37.5%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. LR215003
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18001 : 69535 50 unidentified_phage(25.0%) protease,tRNA,transposase NA
DBSCAN-SWA_2 233796 : 253677 20 Mycoplasma_phage(100.0%) NA NA
DBSCAN-SWA_3 583999 : 594527 15 Mycoplasma_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. LR214999
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR214999_1 100504-100605 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR214999_1 1.1|100527|56|LR214999|CRISPRCasFinder 100527-100582 56 NZ_LR214999 Mycoplasma conjunctivae strain NCTC10147 plasmid 3 100527-100582 0 1.0
LR214999_1 1.1|100527|56|LR214999|CRISPRCasFinder 100527-100582 56 LR214965 Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11 90119-90174 0 1.0

1. spacer 1.1|100527|56|LR214999|CRISPRCasFinder matches to NZ_LR214999 (Mycoplasma conjunctivae strain NCTC10147 plasmid 3) position: , mismatch: 0, identity: 1.0

ttcctacatatattttacattattatgtaacaaaaaagaagattataaaattaatt	CRISPR spacer
ttcctacatatattttacattattatgtaacaaaaaagaagattataaaattaatt	Protospacer
********************************************************

2. spacer 1.1|100527|56|LR214999|CRISPRCasFinder matches to LR214965 (Mycoplasma fermentans strain NCTC10117 genome assembly, plasmid: 11) position: , mismatch: 0, identity: 1.0

ttcctacatatattttacattattatgtaacaaaaaagaagattataaaattaatt	CRISPR spacer
ttcctacatatattttacattattatgtaacaaaaaagaagattataaaattaatt	Protospacer
********************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage