Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
LR215047 Mycoplasma arthritidis strain NCTC10162 genome assembly, chromosome: 1 2 crisprs cas2,csn2,cas9,DEDDh 2 40 1 0

Results visualization

1. LR215047
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR215047_1 539395-541483 TypeII NA
31 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
LR215047_2 694390-694488 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
LR215047_1 1.13|540226|30|LR215047|CRISPRCasFinder,CRT 540226-540255 30 LR215047.1 167406-167435 1 0.967
LR215047_1 1.43|540225|31|LR215047|PILER-CR 540225-540255 31 LR215047.1 167406-167436 1 0.968

1. spacer 1.13|540226|30|LR215047|CRISPRCasFinder,CRT matches to position: 167406-167435, mismatch: 1, identity: 0.967

tgatagtattgtgacatcaatcatgtaatc	CRISPR spacer
tgatattattgtgacatcaatcatgtaatc	Protospacer
***** ************************

2. spacer 1.43|540225|31|LR215047|PILER-CR matches to position: 167406-167436, mismatch: 1, identity: 0.968

ttgatagtattgtgacatcaatcatgtaatc	CRISPR spacer
ttgatattattgtgacatcaatcatgtaatc	Protospacer
****** ************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
LR215047_1 1.24|540953|30|LR215047|CRISPRCasFinder,CRT 540953-540982 30 NC_001942 Mycoplasma phage MAV1, complete genome 4716-4745 0 1.0
LR215047_1 1.24|540953|30|LR215047|CRISPRCasFinder,CRT 540953-540982 30 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 4716-4745 0 1.0
LR215047_1 1.14|540292|30|LR215047|CRISPRCasFinder,CRT 540292-540321 30 NC_001942 Mycoplasma phage MAV1, complete genome 14086-14115 1 0.967
LR215047_1 1.14|540292|30|LR215047|CRISPRCasFinder,CRT 540292-540321 30 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 14086-14115 1 0.967
LR215047_1 1.44|540291|31|LR215047|PILER-CR 540291-540321 31 NC_001942 Mycoplasma phage MAV1, complete genome 14086-14116 1 0.968
LR215047_1 1.44|540291|31|LR215047|PILER-CR 540291-540321 31 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 14086-14116 1 0.968
LR215047_1 1.54|540952|31|LR215047|PILER-CR 540952-540982 31 NC_001942 Mycoplasma phage MAV1, complete genome 4716-4746 1 0.968
LR215047_1 1.54|540952|31|LR215047|PILER-CR 540952-540982 31 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 4716-4746 1 0.968
LR215047_1 1.19|540622|30|LR215047|CRISPRCasFinder,CRT 540622-540651 30 NC_001942 Mycoplasma phage MAV1, complete genome 3277-3306 2 0.933
LR215047_1 1.19|540622|30|LR215047|CRISPRCasFinder,CRT 540622-540651 30 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 3277-3306 2 0.933
LR215047_1 1.49|540621|31|LR215047|PILER-CR 540621-540651 31 NC_001942 Mycoplasma phage MAV1, complete genome 3277-3307 2 0.935
LR215047_1 1.49|540621|31|LR215047|PILER-CR 540621-540651 31 AF074945 Mycoplasma arthritidis bacteriophage MAV1, complete genome 3277-3307 2 0.935
LR215047_2 2.1|694414|51|LR215047|CRISPRCasFinder 694414-694464 51 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 664647-664697 3 0.941
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 MN694791 Marine virus AFVG_250M1163, complete genome 31466-31496 5 0.839
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 MN694323 Marine virus AFVG_250M1162, complete genome 31474-31504 5 0.839
LR215047_1 1.25|541019|30|LR215047|CRISPRCasFinder,CRT 541019-541048 30 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 187392-187421 5 0.833
LR215047_1 1.27|541151|32|LR215047|CRISPRCasFinder,CRT 541151-541182 32 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 704960-704991 5 0.844
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 MN694791 Marine virus AFVG_250M1163, complete genome 31465-31496 5 0.844
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 MN694323 Marine virus AFVG_250M1162, complete genome 31473-31504 5 0.844
LR215047_1 1.57|541150|33|LR215047|PILER-CR 541150-541182 33 NZ_CP032091 Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence 704960-704992 5 0.848
LR215047_1 1.12|540160|30|LR215047|CRISPRCasFinder,CRT 540160-540189 30 NZ_CP018062 Enterococcus mundtii strain DSM 4838 plasmid pLDW-8, complete sequence 34224-34253 6 0.8
LR215047_1 1.14|540292|30|LR215047|CRISPRCasFinder,CRT 540292-540321 30 NC_017240 Borreliella afzelii PKo plasmid lp32-10, complete sequence 2744-2773 6 0.8
LR215047_1 1.15|540358|30|LR215047|CRISPRCasFinder,CRT 540358-540387 30 KT070867 Bacillus phage PBC2, complete genome 15832-15861 6 0.8
LR215047_1 1.16|540424|30|LR215047|CRISPRCasFinder,CRT 540424-540453 30 AP013379 Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C43 29003-29032 6 0.8
LR215047_1 1.18|540556|30|LR215047|CRISPRCasFinder,CRT 540556-540585 30 NZ_CP039853 Salinimonas sp. KX18D6 plasmid plas12, complete sequence 226022-226051 6 0.8
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 AP013589 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C23-MedDCM-OCT-S34-C223, *** SEQUENCING IN PROGRESS *** 1846-1875 6 0.8
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 EU794051 Bacteriophage APSE-4 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5) gene, complete cds; P7 pseudogene, complete sequence; conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds 3091-3120 6 0.8
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 EU794050 Bacteriophage APSE-5 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5), putative Shiga-like toxin beta subunit (P7), conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds 3102-3131 6 0.8
LR215047_1 1.22|540821|30|LR215047|CRISPRCasFinder,CRT 540821-540850 30 NC_022879 Enterococcus mundtii QU 25 plasmid pQY182, complete sequence 162809-162838 6 0.8
LR215047_1 1.48|540555|31|LR215047|PILER-CR 540555-540585 31 NZ_CP039853 Salinimonas sp. KX18D6 plasmid plas12, complete sequence 226022-226052 6 0.806
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 AP013589 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C23-MedDCM-OCT-S34-C223, *** SEQUENCING IN PROGRESS *** 1846-1876 6 0.806
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 EU794051 Bacteriophage APSE-4 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5) gene, complete cds; P7 pseudogene, complete sequence; conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds 3091-3121 6 0.806
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 EU794050 Bacteriophage APSE-5 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5), putative Shiga-like toxin beta subunit (P7), conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds 3102-3132 6 0.806
LR215047_1 1.60|541350|31|LR215047|PILER-CR 541350-541380 31 NC_003240 Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120beta, complete sequence 99636-99666 6 0.806
LR215047_1 1.1|539431|30|LR215047|CRISPRCasFinder,CRT 539431-539460 30 NZ_CP045340 Vibrio sp. THAF190c plasmid pTHAF190c_b, complete sequence 356842-356871 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 NZ_CP023302 Lactobacillus plantarum strain pc-26 plasmid p.pc-2601, complete sequence 29261-29290 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 44813-44842 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 LT615366 Enterococcus phage VPE25 genome assembly, chromosome: VPE25 39181-39210 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 LT546029 Enterococcus phage VFW genome assembly, chromosome: VFW 39112-39141 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 LT546030 Enterococcus phage VPE25 genome assembly, chromosome: I 39181-39210 7 0.767
LR215047_1 1.2|539497|30|LR215047|CRISPRCasFinder,CRT 539497-539526 30 MT119360 Enterococcus phage nattely, complete genome 39272-39301 7 0.767
LR215047_1 1.7|539828|30|LR215047|CRISPRCasFinder,CRT 539828-539857 30 NZ_CP035412 Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence 40326-40355 7 0.767
LR215047_1 1.7|539828|30|LR215047|CRISPRCasFinder,CRT 539828-539857 30 NC_015149 Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631 15440-15469 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054227 Sulfolobus spindle-shaped virus strain NL01B.C01.14.SSV, complete genome 12872-12901 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054236 Sulfolobus spindle-shaped virus strain SSV10, complete genome 8019-8048 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054225 Sulfolobus spindle-shaped virus strain NL01B.C01.09.SSV, complete genome 1796-1825 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054224 Sulfolobus spindle-shaped virus strain NL01B.C01.07.SSV, complete genome 14269-14298 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054230 Sulfolobus spindle-shaped virus strain NL01B.C01.22.SSV, complete genome 14114-14143 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054222 Sulfolobus spindle-shaped virus strain NL01B.C01.05.SSV, complete genome 1373-1402 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054226 Sulfolobus spindle-shaped virus strain NL01B.C01.13.SSV, complete genome 1796-1825 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054229 Sulfolobus spindle-shaped virus strain NL01B.C01.20.SSV, complete genome 1796-1825 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054228 Sulfolobus spindle-shaped virus strain NL01B.C01.18.SSV, complete genome 14676-14705 7 0.767
LR215047_1 1.10|540027|30|LR215047|CRISPRCasFinder,CRT 540027-540056 30 MK054220 Sulfolobus spindle-shaped virus strain NL01B.C01.01.SSV, complete genome 14250-14279 7 0.767
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 MH617241 Microviridae sp. isolate ctda54, complete genome 3277-3307 7 0.774
LR215047_1 1.17|540490|30|LR215047|CRISPRCasFinder,CRT 540490-540519 30 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 89434-89463 7 0.767
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 JF974292 Cyanophage S-SSM2 genomic sequence 122386-122416 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349303 Cyanophage S-RIM14 isolate Sn_11_0110, complete genome 123820-123850 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349304 Cyanophage S-RIM14 isolate Sn_18_0910, complete genome 123042-123072 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349306 Cyanophage S-RIM14 isolate W1_23_0910, complete genome 123046-123076 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349298 Cyanophage S-RIM14 isolate LIS_02_1110, complete genome 123043-123073 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349299 Cyanophage S-RIM14 isolate LIS_22_0610, complete genome 123043-123073 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349305 Cyanophage S-RIM14 isolate Sn_23_0910, complete genome 123044-123074 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349300 Cyanophage S-RIM14 isolate Np_11_1211, complete genome 123044-123074 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NC_015281 Synechococcus phage S-ShM2, complete genome 123047-123077 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349301 Cyanophage S-RIM14 isolate Np_45_0711, complete genome 123043-123073 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 KX349302 Cyanophage S-RIM14 isolate RW_03_0110, complete genome 123043-123073 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP023176 Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence 49084-49114 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP028335 Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence 37123-37153 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP013754 Lactobacillus plantarum strain DF plasmid unnamed1, complete sequence 46848-46878 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP032745 Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence 23584-23614 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP023491 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence 25947-25977 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP046263 Lactobacillus plantarum strain KCCP11226 plasmid pKCCP11226_01, complete sequence 66393-66423 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP013750 Lactobacillus plantarum strain KP plasmid unnamed1, complete sequence 65025-65055 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP017956 Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence 21989-22019 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP026506 Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence 25353-25383 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NC_021527 Lactobacillus plantarum 16 plasmid Lp16G, complete sequence 32239-32269 7 0.774
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP040376 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence 16376-16406 7 0.774
LR215047_1 1.24|540953|30|LR215047|CRISPRCasFinder,CRT 540953-540982 30 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 345017-345046 7 0.767
LR215047_1 1.31|541417|31|LR215047|CRISPRCasFinder,CRT 541417-541447 31 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 117171-117201 7 0.774
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 NC_019772 Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence 154279-154310 7 0.781
LR215047_1 1.42|540159|31|LR215047|PILER-CR 540159-540189 31 NZ_CP018062 Enterococcus mundtii strain DSM 4838 plasmid pLDW-8, complete sequence 34224-34254 7 0.774
LR215047_1 1.44|540291|31|LR215047|PILER-CR 540291-540321 31 NC_017240 Borreliella afzelii PKo plasmid lp32-10, complete sequence 2744-2774 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP047429 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence 62768-62798 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP047429 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence 59659-59689 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP047434 Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6 37136-37166 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP046372 Spiroplasma citri strain LB 319 plasmid pScpLB319-1, complete sequence 17250-17280 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP047440 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence 38945-38975 7 0.774
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP047445 Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-8 38714-38744 7 0.774
LR215047_1 1.46|540423|31|LR215047|PILER-CR 540423-540453 31 AP013379 Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C43 29003-29033 7 0.774
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349303 Cyanophage S-RIM14 isolate Sn_11_0110, complete genome 123820-123851 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349304 Cyanophage S-RIM14 isolate Sn_18_0910, complete genome 123042-123073 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349306 Cyanophage S-RIM14 isolate W1_23_0910, complete genome 123046-123077 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349298 Cyanophage S-RIM14 isolate LIS_02_1110, complete genome 123043-123074 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349299 Cyanophage S-RIM14 isolate LIS_22_0610, complete genome 123043-123074 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349305 Cyanophage S-RIM14 isolate Sn_23_0910, complete genome 123044-123075 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 JF974292 Cyanophage S-SSM2 genomic sequence 122385-122416 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349300 Cyanophage S-RIM14 isolate Np_11_1211, complete genome 123044-123075 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NC_015281 Synechococcus phage S-ShM2, complete genome 123047-123078 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349301 Cyanophage S-RIM14 isolate Np_45_0711, complete genome 123043-123074 7 0.781
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 KX349302 Cyanophage S-RIM14 isolate RW_03_0110, complete genome 123043-123074 7 0.781
LR215047_1 1.52|540820|31|LR215047|PILER-CR 540820-540850 31 NC_022879 Enterococcus mundtii QU 25 plasmid pQY182, complete sequence 162809-162839 7 0.774
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MN966730 Vibrio phage Cilsick, complete genome 39844-39873 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT460516 Vibrio phage Quinn, complete genome 39823-39852 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MG649967 Vibrio virus Thalassa, complete genome 40206-40235 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT460515 Vibrio phage Cody, complete genome 39717-39746 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT448616 Vibrio phage BBMuffin, complete genome 40352-40381 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT460514 Vibrio phage AG74, complete genome 38983-39012 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MK796244 Vibrio phage Achelous, complete genome 38708-38737 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT460518 Vibrio phage Direpillow8, complete genome 40695-40724 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MN966731 Vibrio phage Chazly21, complete genome 39465-39494 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MK907780 Vibrio phage Pontus, complete genome 40337-40366 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MK895508 Vibrio phage Brizo, complete genome 35361-35390 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 NC_042095 Vibrio phage Thalassa, complete genome 40206-40235 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MN958086 Vibrio phage Bennett, complete genome 39340-39369 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT460517 Vibrio phage Athena, complete genome 39671-39700 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT448617 Vibrio phage River4, complete genome 40482-40511 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MT459144 Vibrio phage Dax, complete genome 39932-39961 8 0.733
LR215047_1 1.9|539961|30|LR215047|CRISPRCasFinder,CRT 539961-539990 30 MN966732 Vibrio phage Chester, complete genome 39850-39879 8 0.733
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 375247-375277 8 0.742
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 35252-35282 8 0.742
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 27003-27032 8 0.733
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 85192-85221 8 0.733
LR215047_1 1.20|540688|30|LR215047|CRISPRCasFinder,CRT 540688-540717 30 NC_019358 Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence 2770-2799 8 0.733
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 220904-220934 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 251984-252014 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 256213-256243 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP015177 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence 214036-214066 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 219341-219371 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 233533-233563 8 0.742
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 626388-626418 8 0.742
LR215047_1 1.25|541019|30|LR215047|CRISPRCasFinder,CRT 541019-541048 30 NC_025137 Acinetobacter pittii strain MS32 plasmid pMS32-3, complete sequence 6666-6695 8 0.733
LR215047_1 1.25|541019|30|LR215047|CRISPRCasFinder,CRT 541019-541048 30 NZ_CP026422 Acinetobacter sp. ACNIH1 plasmid pACI-a283, complete sequence 8889-8918 8 0.733
LR215047_1 1.27|541151|32|LR215047|CRISPRCasFinder,CRT 541151-541182 32 MN013189 Microcystis phage Mic1, complete genome 44343-44374 8 0.75
LR215047_1 1.29|541285|30|LR215047|CRISPRCasFinder,CRT 541285-541314 30 MN855828 Bacteriophage sp. isolate 175, complete genome 1184-1213 8 0.733
LR215047_1 1.31|541417|31|LR215047|CRISPRCasFinder,CRT 541417-541447 31 NC_019924 Clostridium phage phi8074-B1, complete genome 28333-28363 8 0.742
LR215047_1 1.32|539496|31|LR215047|PILER-CR 539496-539526 31 NZ_CP023302 Lactobacillus plantarum strain pc-26 plasmid p.pc-2601, complete sequence 29260-29290 8 0.742
LR215047_1 1.37|539827|31|LR215047|PILER-CR 539827-539857 31 NZ_CP035412 Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence 40325-40355 8 0.742
LR215047_1 1.37|539827|31|LR215047|PILER-CR 539827-539857 31 NC_015149 Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631 15440-15470 8 0.742
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP017776 Bacillus velezensis strain 9912D plasmid p9912D, complete sequence 310-340 8 0.742
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NC_015845 Enterococcus hirae ATCC 9790 plasmid pTG9790, complete sequence 21519-21549 8 0.742
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP030098 Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence 13943-13973 8 0.742
LR215047_1 1.45|540357|31|LR215047|PILER-CR 540357-540387 31 NZ_CP030098 Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence 49343-49373 8 0.742
LR215047_1 1.47|540489|31|LR215047|PILER-CR 540489-540519 31 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 89434-89464 8 0.742
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 NC_019358 Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence 2770-2800 8 0.742
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 220903-220934 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 251983-252014 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 256212-256243 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP013754 Lactobacillus plantarum strain DF plasmid unnamed1, complete sequence 46848-46879 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP032745 Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence 23584-23615 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 626388-626419 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP015177 Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence 214035-214066 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP023491 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence 25947-25978 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP046263 Lactobacillus plantarum strain KCCP11226 plasmid pKCCP11226_01, complete sequence 66393-66424 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP013750 Lactobacillus plantarum strain KP plasmid unnamed1, complete sequence 65025-65056 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 219340-219371 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP017956 Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence 21989-22020 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP023176 Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence 49083-49114 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP026506 Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence 25353-25384 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NC_021527 Lactobacillus plantarum 16 plasmid Lp16G, complete sequence 32239-32270 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 233532-233563 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP040376 Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence 16376-16407 8 0.75
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 NZ_CP028335 Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence 37122-37153 8 0.75
LR215047_1 1.54|540952|31|LR215047|PILER-CR 540952-540982 31 CP013001 Bacillus thuringiensis strain XL6 plasmid, complete sequence 345017-345047 8 0.742
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 391213-391243 9 0.71
LR215047_1 1.11|540093|31|LR215047|CRISPRCasFinder,CRT 540093-540123 31 MN855768 Siphoviridae sp. isolate 183, complete genome 12823-12853 9 0.71
LR215047_1 1.15|540358|30|LR215047|CRISPRCasFinder,CRT 540358-540387 30 LR026976 Bacillus pumilus isolate 1 genome assembly, plasmid: p576 22437-22466 9 0.7
LR215047_1 1.21|540754|31|LR215047|CRISPRCasFinder,CRT 540754-540784 31 JQ062992 Bacillus phage phIS3501, complete genome 13361-13391 9 0.71
LR215047_1 1.27|541151|32|LR215047|CRISPRCasFinder,CRT 541151-541182 32 MN693352 Marine virus AFVG_25M558, complete genome 26479-26510 9 0.719
LR215047_1 1.31|541417|31|LR215047|CRISPRCasFinder,CRT 541417-541447 31 NZ_CP040853 Lactobacillus murinus strain V10 plasmid unnamed, complete sequence 46338-46368 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MN966730 Vibrio phage Cilsick, complete genome 39844-39874 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT460516 Vibrio phage Quinn, complete genome 39823-39853 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MG649967 Vibrio virus Thalassa, complete genome 40206-40236 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT460515 Vibrio phage Cody, complete genome 39717-39747 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT448616 Vibrio phage BBMuffin, complete genome 40352-40382 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT460514 Vibrio phage AG74, complete genome 38983-39013 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MK796244 Vibrio phage Achelous, complete genome 38708-38738 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT460518 Vibrio phage Direpillow8, complete genome 40695-40725 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MN966731 Vibrio phage Chazly21, complete genome 39465-39495 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MK907780 Vibrio phage Pontus, complete genome 40337-40367 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MK895508 Vibrio phage Brizo, complete genome 35361-35391 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 NC_042095 Vibrio phage Thalassa, complete genome 40206-40236 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MN958086 Vibrio phage Bennett, complete genome 39340-39370 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT460517 Vibrio phage Athena, complete genome 39671-39701 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT448617 Vibrio phage River4, complete genome 40482-40512 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MT459144 Vibrio phage Dax, complete genome 39932-39962 9 0.71
LR215047_1 1.39|539960|31|LR215047|PILER-CR 539960-539990 31 MN966732 Vibrio phage Chester, complete genome 39850-39880 9 0.71
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 NZ_LR214939 Mycoplasma salivarium strain NCTC10113 plasmid 2 375247-375278 9 0.719
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 35252-35283 9 0.719
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 85191-85221 9 0.71
LR215047_1 1.50|540687|31|LR215047|PILER-CR 540687-540717 31 NZ_CP024793 Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence 27003-27033 9 0.71
LR215047_1 1.55|541018|31|LR215047|PILER-CR 541018-541048 31 NC_025137 Acinetobacter pittii strain MS32 plasmid pMS32-3, complete sequence 6666-6696 9 0.71
LR215047_1 1.55|541018|31|LR215047|PILER-CR 541018-541048 31 NZ_CP026422 Acinetobacter sp. ACNIH1 plasmid pACI-a283, complete sequence 8889-8919 9 0.71
LR215047_1 1.57|541150|33|LR215047|PILER-CR 541150-541182 33 MN013189 Microcystis phage Mic1, complete genome 44342-44374 9 0.727
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 NZ_LR134403 Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence 391212-391243 10 0.688
LR215047_1 1.41|540092|32|LR215047|PILER-CR 540092-540123 32 MN855768 Siphoviridae sp. isolate 183, complete genome 12822-12853 10 0.688
LR215047_1 1.51|540753|32|LR215047|PILER-CR 540753-540784 32 JQ062992 Bacillus phage phIS3501, complete genome 13360-13391 10 0.688

1. spacer 1.24|540953|30|LR215047|CRISPRCasFinder,CRT matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 0, identity: 1.0

tttcacacttcttgtattgcaggtgattta	CRISPR spacer
tttcacacttcttgtattgcaggtgattta	Protospacer
******************************

2. spacer 1.24|540953|30|LR215047|CRISPRCasFinder,CRT matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 0, identity: 1.0

tttcacacttcttgtattgcaggtgattta	CRISPR spacer
tttcacacttcttgtattgcaggtgattta	Protospacer
******************************

3. spacer 1.14|540292|30|LR215047|CRISPRCasFinder,CRT matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 1, identity: 0.967

tcattttgattatatacttgcttcggcata	CRISPR spacer
tcattttgattatacacttgcttcggcata	Protospacer
**************.***************

4. spacer 1.14|540292|30|LR215047|CRISPRCasFinder,CRT matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 1, identity: 0.967

tcattttgattatatacttgcttcggcata	CRISPR spacer
tcattttgattatacacttgcttcggcata	Protospacer
**************.***************

5. spacer 1.44|540291|31|LR215047|PILER-CR matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 1, identity: 0.968

ttcattttgattatatacttgcttcggcata	CRISPR spacer
ttcattttgattatacacttgcttcggcata	Protospacer
***************.***************

6. spacer 1.44|540291|31|LR215047|PILER-CR matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 1, identity: 0.968

ttcattttgattatatacttgcttcggcata	CRISPR spacer
ttcattttgattatacacttgcttcggcata	Protospacer
***************.***************

7. spacer 1.54|540952|31|LR215047|PILER-CR matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 1, identity: 0.968

ttttcacacttcttgtattgcaggtgattta	CRISPR spacer
gtttcacacttcttgtattgcaggtgattta	Protospacer
 ******************************

8. spacer 1.54|540952|31|LR215047|PILER-CR matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 1, identity: 0.968

ttttcacacttcttgtattgcaggtgattta	CRISPR spacer
gtttcacacttcttgtattgcaggtgattta	Protospacer
 ******************************

9. spacer 1.19|540622|30|LR215047|CRISPRCasFinder,CRT matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 2, identity: 0.933

tcgaagttttcaaaataaatcgctctgcca	CRISPR spacer
tcgaagttttcgaaaaaaatcgctctgcca	Protospacer
***********.*** **************

10. spacer 1.19|540622|30|LR215047|CRISPRCasFinder,CRT matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 2, identity: 0.933

tcgaagttttcaaaataaatcgctctgcca	CRISPR spacer
tcgaagttttcgaaaaaaatcgctctgcca	Protospacer
***********.*** **************

11. spacer 1.49|540621|31|LR215047|PILER-CR matches to NC_001942 (Mycoplasma phage MAV1, complete genome) position: , mismatch: 2, identity: 0.935

ttcgaagttttcaaaataaatcgctctgcca	CRISPR spacer
ttcgaagttttcgaaaaaaatcgctctgcca	Protospacer
************.*** **************

12. spacer 1.49|540621|31|LR215047|PILER-CR matches to AF074945 (Mycoplasma arthritidis bacteriophage MAV1, complete genome) position: , mismatch: 2, identity: 0.935

ttcgaagttttcaaaataaatcgctctgcca	CRISPR spacer
ttcgaagttttcgaaaaaaatcgctctgcca	Protospacer
************.*** **************

13. spacer 2.1|694414|51|LR215047|CRISPRCasFinder matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 3, identity: 0.941

tagattggcaacctaatgttctaccattgaactacatccgc-atggtgcaag	CRISPR spacer
cagattggcaacctgatgttctaccattgaactacatccgcaatggtgcaa-	Protospacer
.*************.************************** ********* 

14. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to MN694791 (Marine virus AFVG_250M1163, complete genome) position: , mismatch: 5, identity: 0.839

tcttaacctttcagttaattctgcaatttta--	CRISPR spacer
acttaacctttcatttaagtctgc--ttttaac	Protospacer
 ************ **** *****  *****  

15. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to MN694323 (Marine virus AFVG_250M1162, complete genome) position: , mismatch: 5, identity: 0.839

tcttaacctttcagttaattctgcaatttta--	CRISPR spacer
acttaacctttcatttaagtctgc--ttttaac	Protospacer
 ************ **** *****  *****  

16. spacer 1.25|541019|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 5, identity: 0.833

aaaaccaggccactatatttttataaaaat	CRISPR spacer
aaataaaggccacactatttttataaaaat	Protospacer
***   *******  ***************

17. spacer 1.27|541151|32|LR215047|CRISPRCasFinder,CRT matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tcttaattcttttaaactgtctgctttgttga-	CRISPR spacer
tcttaattctttaatactgtctgc-taattgat	Protospacer
************ * ********* * .**** 

18. spacer 1.41|540092|32|LR215047|PILER-CR matches to MN694791 (Marine virus AFVG_250M1163, complete genome) position: , mismatch: 5, identity: 0.844

ttcttaacctttcagttaattctgcaatttta--	CRISPR spacer
tacttaacctttcatttaagtctgc--ttttaac	Protospacer
* ************ **** *****  *****  

19. spacer 1.41|540092|32|LR215047|PILER-CR matches to MN694323 (Marine virus AFVG_250M1162, complete genome) position: , mismatch: 5, identity: 0.844

ttcttaacctttcagttaattctgcaatttta--	CRISPR spacer
tacttaacctttcatttaagtctgc--ttttaac	Protospacer
* ************ **** *****  *****  

20. spacer 1.57|541150|33|LR215047|PILER-CR matches to NZ_CP032091 (Pseudoalteromonas donghaensis strain HJ51 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.848

ctcttaattcttttaaactgtctgctttgttga-	CRISPR spacer
ctcttaattctttaatactgtctgc-taattgat	Protospacer
************* * ********* * .**** 

21. spacer 1.12|540160|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP018062 (Enterococcus mundtii strain DSM 4838 plasmid pLDW-8, complete sequence) position: , mismatch: 6, identity: 0.8

attta---taataattttcatgcgtaaattcct	CRISPR spacer
---taaacgaataaatttcatgcttaaattcct	Protospacer
   **    ***** ******** *********

22. spacer 1.14|540292|30|LR215047|CRISPRCasFinder,CRT matches to NC_017240 (Borreliella afzelii PKo plasmid lp32-10, complete sequence) position: , mismatch: 6, identity: 0.8

tcattttgattatatacttgcttcggcata	CRISPR spacer
tcattttgattatttacttggtttttaata	Protospacer
************* ****** **.   ***

23. spacer 1.15|540358|30|LR215047|CRISPRCasFinder,CRT matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 6, identity: 0.8

taatgataataacgattatgatctagttgt--	CRISPR spacer
gaatgataataaagattatga--tagctattt	Protospacer
 *********** ********  ***.*.*  

24. spacer 1.16|540424|30|LR215047|CRISPRCasFinder,CRT matches to AP013379 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C43) position: , mismatch: 6, identity: 0.8

tcagccagaattgttttttagtcaatcagt	CRISPR spacer
taatactaaattgttttttagtccatcagt	Protospacer
* *  * .*************** ******

25. spacer 1.18|540556|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP039853 (Salinimonas sp. KX18D6 plasmid plas12, complete sequence) position: , mismatch: 6, identity: 0.8

tgataaaaccagtgcaaaattgattggata	CRISPR spacer
tgataaatccagtgcaaagttgattaaagc	Protospacer
******* **********.******..*  

26. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to AP013589 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C23-MedDCM-OCT-S34-C223, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8

ggtcacta-----taaataacttcaataaaatttt	CRISPR spacer
-----ctagcaactaaataacttctataaaatttt	Protospacer
     ***     *********** **********

27. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to EU794051 (Bacteriophage APSE-4 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5) gene, complete cds; P7 pseudogene, complete sequence; conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds) position: , mismatch: 6, identity: 0.8

ggtcactataaataacttcaataaaatttt	CRISPR spacer
gattgctataaattacttctataaaatttg	Protospacer
*.*..******** ***** ********* 

28. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to EU794050 (Bacteriophage APSE-5 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5), putative Shiga-like toxin beta subunit (P7), conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds) position: , mismatch: 6, identity: 0.8

ggtcactataaataacttcaataaaatttt	CRISPR spacer
gattgctataaattacttctataaaatttg	Protospacer
*.*..******** ***** ********* 

29. spacer 1.22|540821|30|LR215047|CRISPRCasFinder,CRT matches to NC_022879 (Enterococcus mundtii QU 25 plasmid pQY182, complete sequence) position: , mismatch: 6, identity: 0.8

ctttttctcttttagcatcggaaaaaataa	CRISPR spacer
aatttactcttttagcatcggaaaattgaa	Protospacer
  *** *******************   **

30. spacer 1.48|540555|31|LR215047|PILER-CR matches to NZ_CP039853 (Salinimonas sp. KX18D6 plasmid plas12, complete sequence) position: , mismatch: 6, identity: 0.806

ttgataaaaccagtgcaaaattgattggata	CRISPR spacer
ttgataaatccagtgcaaagttgattaaagc	Protospacer
******** **********.******..*  

31. spacer 1.50|540687|31|LR215047|PILER-CR matches to AP013589 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C23-MedDCM-OCT-S34-C223, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.806

--tggtcactataaataacttcaataaaatttt	CRISPR spacer
tctagcaac--taaataacttctataaaatttt	Protospacer
  *.*. **  *********** **********

32. spacer 1.50|540687|31|LR215047|PILER-CR matches to EU794051 (Bacteriophage APSE-4 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5) gene, complete cds; P7 pseudogene, complete sequence; conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds) position: , mismatch: 6, identity: 0.806

tggtcactataaataacttcaataaaatttt	CRISPR spacer
tgattgctataaattacttctataaaatttg	Protospacer
**.*..******** ***** ********* 

33. spacer 1.50|540687|31|LR215047|PILER-CR matches to EU794050 (Bacteriophage APSE-5 predicted P-loop ATPase (P3) gene, partial cds; P4 pseudogene, complete sequence; Q protein (P5), putative Shiga-like toxin beta subunit (P7), conserved hypothetical protein (P8), putative Shiga-like toxin alpha subunit (P9), conserved hypothetical protein (P10), lambda-like group I holin (P11), lysozyme (P13), conserved hypothetical protein (P14), conserved hypothetical protein (P16), conserved hypothetical protein (P17), terminase (P18), portal protein (P19), and scaffold protein gp8 (P23) genes, complete cds; and head protein (P24) gene, partial cds) position: , mismatch: 6, identity: 0.806

tggtcactataaataacttcaataaaatttt	CRISPR spacer
tgattgctataaattacttctataaaatttg	Protospacer
**.*..******** ***** ********* 

34. spacer 1.60|541350|31|LR215047|PILER-CR matches to NC_003240 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120beta, complete sequence) position: , mismatch: 6, identity: 0.806

ctttttcattgctactctaattg---ggtttgcc	CRISPR spacer
ctttttcattgctcccctaattgagaagttt---	Protospacer
************* *.*******   .****   

35. spacer 1.1|539431|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP045340 (Vibrio sp. THAF190c plasmid pTHAF190c_b, complete sequence) position: , mismatch: 7, identity: 0.767

atttaatagaacaattaaacctgattatat	CRISPR spacer
tttcgatagaacaattaagccagattattg	Protospacer
 **..*************.** ******  

36. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP023302 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2601, complete sequence) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
gcaatggttttctaataattcaccgatata	Protospacer
. * * *** ************ ****** 

37. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
aaattttttatctaataattcgtgcataac	Protospacer
****** **************.   *** .

38. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to LT615366 (Enterococcus phage VPE25 genome assembly, chromosome: VPE25) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
aaattttttatctaataattcgtgcataac	Protospacer
****** **************.   *** .

39. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to LT546029 (Enterococcus phage VFW genome assembly, chromosome: VFW) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
aaattttttatctaataattcgtgcataac	Protospacer
****** **************.   *** .

40. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to LT546030 (Enterococcus phage VPE25 genome assembly, chromosome: I) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
aaattttttatctaataattcgtgcataac	Protospacer
****** **************.   *** .

41. spacer 1.2|539497|30|LR215047|CRISPRCasFinder,CRT matches to MT119360 (Enterococcus phage nattely, complete genome) position: , mismatch: 7, identity: 0.767

aaatttgttatctaataattcagcgatatt	CRISPR spacer
aaattttttatctaataattcgtgcataac	Protospacer
****** **************.   *** .

42. spacer 1.7|539828|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP035412 (Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

tattttcagttcaaatttgcttaatacctt	CRISPR spacer
caaagccagtttaaatttgcttaatatctt	Protospacer
.*   .*****.**************.***

43. spacer 1.7|539828|30|LR215047|CRISPRCasFinder,CRT matches to NC_015149 (Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631) position: , mismatch: 7, identity: 0.767

tattttcagttcaaatttgcttaatacctt	CRISPR spacer
caaagccagtttaaatttgcttaatatctt	Protospacer
.*   .*****.**************.***

44. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054227 (Sulfolobus spindle-shaped virus strain NL01B.C01.14.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

45. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054236 (Sulfolobus spindle-shaped virus strain SSV10, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

46. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054225 (Sulfolobus spindle-shaped virus strain NL01B.C01.09.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

47. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054224 (Sulfolobus spindle-shaped virus strain NL01B.C01.07.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

48. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054230 (Sulfolobus spindle-shaped virus strain NL01B.C01.22.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

49. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054222 (Sulfolobus spindle-shaped virus strain NL01B.C01.05.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

50. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054226 (Sulfolobus spindle-shaped virus strain NL01B.C01.13.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

51. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054229 (Sulfolobus spindle-shaped virus strain NL01B.C01.20.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

52. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054228 (Sulfolobus spindle-shaped virus strain NL01B.C01.18.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

53. spacer 1.10|540027|30|LR215047|CRISPRCasFinder,CRT matches to MK054220 (Sulfolobus spindle-shaped virus strain NL01B.C01.01.SSV, complete genome) position: , mismatch: 7, identity: 0.767

attaacttttgttatgctgtgaaaaccgta	CRISPR spacer
accgaatattgttatgctttgaaaaccgtt	Protospacer
*...* * ********** ********** 

54. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to MH617241 (Microviridae sp. isolate ctda54, complete genome) position: , mismatch: 7, identity: 0.774

tcttaacctttcagttaattctgcaatttta	CRISPR spacer
tttgattctttcagttgattctgcaatttgt	Protospacer
*.* * .*********.************  

55. spacer 1.17|540490|30|LR215047|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 7, identity: 0.767

ccagccagcattactttttagtcaatcagt	CRISPR spacer
tcagccagcatgactttttcgtcatcctga	Protospacer
.********** ******* **** .* * 

56. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to JF974292 (Cyanophage S-SSM2 genomic sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

57. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349303 (Cyanophage S-RIM14 isolate Sn_11_0110, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

58. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349304 (Cyanophage S-RIM14 isolate Sn_18_0910, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

59. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349306 (Cyanophage S-RIM14 isolate W1_23_0910, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

60. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349298 (Cyanophage S-RIM14 isolate LIS_02_1110, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

61. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349299 (Cyanophage S-RIM14 isolate LIS_22_0610, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

62. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349305 (Cyanophage S-RIM14 isolate Sn_23_0910, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

63. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349300 (Cyanophage S-RIM14 isolate Np_11_1211, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

64. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NC_015281 (Synechococcus phage S-ShM2, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

65. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349301 (Cyanophage S-RIM14 isolate Np_45_0711, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

66. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to KX349302 (Cyanophage S-RIM14 isolate RW_03_0110, complete genome) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
tagctgcttctaaagaattgaaattgattga	Protospacer
  *  ****.****************** .*

67. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

68. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

69. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP013754 (Lactobacillus plantarum strain DF plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

70. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

71. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

72. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP046263 (Lactobacillus plantarum strain KCCP11226 plasmid pKCCP11226_01, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

73. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP013750 (Lactobacillus plantarum strain KP plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

74. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

75. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

76. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

77. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP040376 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
cttaattttttaaataattgaaattgatcaa	Protospacer
 . ** .******* ************* **

78. spacer 1.24|540953|30|LR215047|CRISPRCasFinder,CRT matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

tttcacacttcttgtattgcaggtgattta	CRISPR spacer
ctcaccacttctggtattgcatgtgatttt	Protospacer
.*.  ******* ******** ******* 

79. spacer 1.31|541417|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 7, identity: 0.774

atttaggattgtatttttgaactgtccctaa---	CRISPR spacer
ctatagtattgtttttttgaactgtc---aaatt	Protospacer
 * *** ***** *************   **   

80. spacer 1.41|540092|32|LR215047|PILER-CR matches to NC_019772 (Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence) position: , mismatch: 7, identity: 0.781

ttcttaacctttcagttaattct-gcaatttta	CRISPR spacer
ttcttaaccttttacttaattctaaccatgtc-	Protospacer
************.* ******** .* ** *. 

81. spacer 1.42|540159|31|LR215047|PILER-CR matches to NZ_CP018062 (Enterococcus mundtii strain DSM 4838 plasmid pLDW-8, complete sequence) position: , mismatch: 7, identity: 0.774

tattta---taataattttcatgcgtaaattcct	CRISPR spacer
---ctaaacgaataaatttcatgcttaaattcct	Protospacer
   .**    ***** ******** *********

82. spacer 1.44|540291|31|LR215047|PILER-CR matches to NC_017240 (Borreliella afzelii PKo plasmid lp32-10, complete sequence) position: , mismatch: 7, identity: 0.774

ttcattttgattatatacttgcttcggcata	CRISPR spacer
atcattttgattatttacttggtttttaata	Protospacer
 ************* ****** **.   ***

83. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

84. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP047429 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-1, complete sequence) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

85. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP047434 (Spiroplasma citri strain BLH-13 plasmid pSciBLH13-6) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

86. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP046372 (Spiroplasma citri strain LB 319 plasmid pScpLB319-1, complete sequence) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

87. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP047440 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-3, complete sequence) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

88. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP047445 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-8) position: , mismatch: 7, identity: 0.774

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaatgaaaataacgagtatgataaatattt	Protospacer
******* ******** ******  *  * *

89. spacer 1.46|540423|31|LR215047|PILER-CR matches to AP013379 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G14, isolate: uvMED-CGR-U-MedDCM-OCT-S28-C43) position: , mismatch: 7, identity: 0.774

ttcagccagaattgttttttagtcaatcagt	CRISPR spacer
gtaatactaaattgttttttagtccatcagt	Protospacer
 * *  * .*************** ******

90. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349303 (Cyanophage S-RIM14 isolate Sn_11_0110, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

91. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349304 (Cyanophage S-RIM14 isolate Sn_18_0910, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

92. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349306 (Cyanophage S-RIM14 isolate W1_23_0910, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

93. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349298 (Cyanophage S-RIM14 isolate LIS_02_1110, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

94. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349299 (Cyanophage S-RIM14 isolate LIS_22_0610, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

95. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349305 (Cyanophage S-RIM14 isolate Sn_23_0910, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

96. spacer 1.51|540753|32|LR215047|PILER-CR matches to JF974292 (Cyanophage S-SSM2 genomic sequence) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

97. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349300 (Cyanophage S-RIM14 isolate Np_11_1211, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

98. spacer 1.51|540753|32|LR215047|PILER-CR matches to NC_015281 (Synechococcus phage S-ShM2, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

99. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349301 (Cyanophage S-RIM14 isolate Np_45_0711, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

100. spacer 1.51|540753|32|LR215047|PILER-CR matches to KX349302 (Cyanophage S-RIM14 isolate RW_03_0110, complete genome) position: , mismatch: 7, identity: 0.781

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ttagctgcttctaaagaattgaaattgattga	Protospacer
*  *  ****.****************** .*

101. spacer 1.52|540820|31|LR215047|PILER-CR matches to NC_022879 (Enterococcus mundtii QU 25 plasmid pQY182, complete sequence) position: , mismatch: 7, identity: 0.774

tctttttctcttttagcatcggaaaaaataa	CRISPR spacer
aaatttactcttttagcatcggaaaattgaa	Protospacer
   *** *******************   **

102. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MN966730 (Vibrio phage Cilsick, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

103. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT460516 (Vibrio phage Quinn, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

104. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MG649967 (Vibrio virus Thalassa, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

105. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT460515 (Vibrio phage Cody, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

106. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT448616 (Vibrio phage BBMuffin, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

107. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT460514 (Vibrio phage AG74, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

108. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MK796244 (Vibrio phage Achelous, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

109. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT460518 (Vibrio phage Direpillow8, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

110. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MN966731 (Vibrio phage Chazly21, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

111. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MK907780 (Vibrio phage Pontus, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

112. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MK895508 (Vibrio phage Brizo, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

113. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to NC_042095 (Vibrio phage Thalassa, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

114. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MN958086 (Vibrio phage Bennett, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

115. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT460517 (Vibrio phage Athena, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

116. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT448617 (Vibrio phage River4, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

117. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MT459144 (Vibrio phage Dax, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

118. spacer 1.9|539961|30|LR215047|CRISPRCasFinder,CRT matches to MN966732 (Vibrio phage Chester, complete genome) position: , mismatch: 8, identity: 0.733

aattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
cgtccacagatgctaaccgtaaaaaattct	Protospacer
 .*.** ***** **************   

119. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 8, identity: 0.742

tcttaacctttcagttaattctgcaatttta	CRISPR spacer
attaattttttcagttaattcaacaatttta	Protospacer
 .* * ..************* .********

120. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 8, identity: 0.742

tcttaacctttcagttaattctgcaatttta	CRISPR spacer
cctatctttttcagttaattcttcaatctta	Protospacer
.**   ..************** ****.***

121. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 8, identity: 0.733

ggtcactataaataacttcaataaaatttt	CRISPR spacer
aacaactgtaaataactgcaataaaattgg	Protospacer
... ***.********* **********  

122. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 8, identity: 0.733

ggtcactataaataacttcaataaaatttt	CRISPR spacer
aacaactgtaaataactgcaataaaattgg	Protospacer
... ***.********* **********  

123. spacer 1.20|540688|30|LR215047|CRISPRCasFinder,CRT matches to NC_019358 (Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence) position: , mismatch: 8, identity: 0.733

ggtcactataaataacttcaataaaatttt	CRISPR spacer
agagcctataattaacttcattaaaattga	Protospacer
.*   ****** ******** *******  

124. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

125. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

126. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

127. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

128. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

129. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

130. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 8, identity: 0.742

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aaactaattttatacaattgaaattgataaa	Protospacer
* .  . ***** * ****************

131. spacer 1.25|541019|30|LR215047|CRISPRCasFinder,CRT matches to NC_025137 (Acinetobacter pittii strain MS32 plasmid pMS32-3, complete sequence) position: , mismatch: 8, identity: 0.733

aaaaccaggccactatatttttataaaaat	CRISPR spacer
gtcgcttcgccactaaatttttataaaaat	Protospacer
.  .*.  ******* **************

132. spacer 1.25|541019|30|LR215047|CRISPRCasFinder,CRT matches to NZ_CP026422 (Acinetobacter sp. ACNIH1 plasmid pACI-a283, complete sequence) position: , mismatch: 8, identity: 0.733

aaaaccaggccactatatttttataaaaat	CRISPR spacer
gtggcttcgccactaaatttttataaaaat	Protospacer
. ..*.  ******* **************

133. spacer 1.27|541151|32|LR215047|CRISPRCasFinder,CRT matches to MN013189 (Microcystis phage Mic1, complete genome) position: , mismatch: 8, identity: 0.75

tcttaattcttttaaactgtctgctttgttga	CRISPR spacer
tcttaattctttaaagctgtctgcggcatttt	Protospacer
************ **.********  ..**  

134. spacer 1.29|541285|30|LR215047|CRISPRCasFinder,CRT matches to MN855828 (Bacteriophage sp. isolate 175, complete genome) position: , mismatch: 8, identity: 0.733

ttttgccacaaaactacaggagcttttgtt	CRISPR spacer
aaacgtgataaaactacaggagcatttgtt	Protospacer
   .*. *.************** ******

135. spacer 1.31|541417|31|LR215047|CRISPRCasFinder,CRT matches to NC_019924 (Clostridium phage phi8074-B1, complete genome) position: , mismatch: 8, identity: 0.742

atttaggattgtatttttgaactgtccctaa	CRISPR spacer
tccaaccactgtatttttgaactgtccataa	Protospacer
 .. *  *.****************** ***

136. spacer 1.32|539496|31|LR215047|PILER-CR matches to NZ_CP023302 (Lactobacillus plantarum strain pc-26 plasmid p.pc-2601, complete sequence) position: , mismatch: 8, identity: 0.742

taaatttgttatctaataattcagcgatatt	CRISPR spacer
cgcaatggttttctaataattcaccgatata	Protospacer
.. * * *** ************ ****** 

137. spacer 1.37|539827|31|LR215047|PILER-CR matches to NZ_CP035412 (Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ttattttcagttcaaatttgcttaatacctt	CRISPR spacer
acaaagccagtttaaatttgcttaatatctt	Protospacer
 .*   .*****.**************.***

138. spacer 1.37|539827|31|LR215047|PILER-CR matches to NC_015149 (Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631) position: , mismatch: 8, identity: 0.742

ttattttcagttcaaatttgcttaatacctt	CRISPR spacer
acaaagccagtttaaatttgcttaatatctt	Protospacer
 .*   .*****.**************.***

139. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP017776 (Bacillus velezensis strain 9912D plasmid p9912D, complete sequence) position: , mismatch: 8, identity: 0.742

ttaatgataataacgattatgat-ctagttgt	CRISPR spacer
ttaatcataataacgatcatgataacaatca-	Protospacer
***** ***********.*****  .*.*.. 

140. spacer 1.45|540357|31|LR215047|PILER-CR matches to NC_015845 (Enterococcus hirae ATCC 9790 plasmid pTG9790, complete sequence) position: , mismatch: 8, identity: 0.742

ttaatgataataacgattatgatctagttgt	CRISPR spacer
ttaataataattacgattatgatgtcaaaat	Protospacer
*****.***** *********** * .  .*

141. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP030098 (Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence) position: , mismatch: 8, identity: 0.742

ttaatgataataacgattatgat-ctagttgt	CRISPR spacer
ttaatcataataacgatcatgataacaatca-	Protospacer
***** ***********.*****  .*.*.. 

142. spacer 1.45|540357|31|LR215047|PILER-CR matches to NZ_CP030098 (Bacillus amyloliquefaciens strain SH-B74 plasmid pSH-B74, complete sequence) position: , mismatch: 8, identity: 0.742

ttaatgataataacgattatgat-ctagttgt	CRISPR spacer
ttaatcataataacgatcatgataacaatca-	Protospacer
***** ***********.*****  .*.*.. 

143. spacer 1.47|540489|31|LR215047|PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 8, identity: 0.742

tccagccagcattactttttagtcaatcagt	CRISPR spacer
atcagccagcatgactttttcgtcatcctga	Protospacer
 .********** ******* **** .* * 

144. spacer 1.50|540687|31|LR215047|PILER-CR matches to NC_019358 (Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence) position: , mismatch: 8, identity: 0.742

tggtcactataaataacttcaataaaatttt	CRISPR spacer
tagagcctataattaacttcattaaaattga	Protospacer
*.*   ****** ******** *******  

145. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

146. spacer 1.51|540753|32|LR215047|PILER-CR matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

147. spacer 1.51|540753|32|LR215047|PILER-CR matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

148. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP013754 (Lactobacillus plantarum strain DF plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

149. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP032745 (Lactobacillus paraplantarum strain DSM 10667 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

150. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

151. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

152. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP023491 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

153. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP046263 (Lactobacillus plantarum strain KCCP11226 plasmid pKCCP11226_01, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

154. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP013750 (Lactobacillus plantarum strain KP plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

155. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

156. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP017956 (Lactobacillus plantarum strain C410L1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

157. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP023176 (Lactobacillus plantarum strain BDGP2 plasmid pLtBDGP2B, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

158. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP026506 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

159. spacer 1.51|540753|32|LR215047|PILER-CR matches to NC_021527 (Lactobacillus plantarum 16 plasmid Lp16G, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

160. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
taaactaattttatacaattgaaattgataaa	Protospacer
** .  . ***** * ****************

161. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP040376 (Lactobacillus plantarum subsp. plantarum strain BNH17 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

162. spacer 1.51|540753|32|LR215047|PILER-CR matches to NZ_CP028335 (Lactobacillus plantarum strain SRCM101167 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
ccttaattttttaaataattgaaattgatcaa	Protospacer
. . ** .******* ************* **

163. spacer 1.54|540952|31|LR215047|PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

ttttcacacttcttgtattgcaggtgattta	CRISPR spacer
actcaccacttctggtattgcatgtgatttt	Protospacer
 .*.  ******* ******** ******* 

164. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 9, identity: 0.71

tcttaacctttcagttaattctgcaatttta	CRISPR spacer
aacaaggctttcagttaattaagcaattttt	Protospacer
  . *. *************  ******** 

165. spacer 1.11|540093|31|LR215047|CRISPRCasFinder,CRT matches to MN855768 (Siphoviridae sp. isolate 183, complete genome) position: , mismatch: 9, identity: 0.71

tcttaacctttcagttaattctgcaatttta	CRISPR spacer
ccttatcctttcggttaattctgcgacccat	Protospacer
.**** ******.***********.*...  

166. spacer 1.15|540358|30|LR215047|CRISPRCasFinder,CRT matches to LR026976 (Bacillus pumilus isolate 1 genome assembly, plasmid: p576) position: , mismatch: 9, identity: 0.7

taatgataataacgattatgatctagttgt	CRISPR spacer
taatgataataacgatgatgaatacaaaat	Protospacer
**************** **** .  .  .*

167. spacer 1.21|540754|31|LR215047|CRISPRCasFinder,CRT matches to JQ062992 (Bacillus phage phIS3501, complete genome) position: , mismatch: 9, identity: 0.71

acgaagcttttaaagaattgaaattgataaa	CRISPR spacer
agaggagttttaaagaatttaaattgacaat	Protospacer
* .... ************ *******.** 

168. spacer 1.27|541151|32|LR215047|CRISPRCasFinder,CRT matches to MN693352 (Marine virus AFVG_25M558, complete genome) position: , mismatch: 9, identity: 0.719

tcttaattcttttaaactgtctgctttgttga--	CRISPR spacer
tcttaattcttttaaattatctg--gcactaaat	Protospacer
****************.*.****   ...*.*  

169. spacer 1.31|541417|31|LR215047|CRISPRCasFinder,CRT matches to NZ_CP040853 (Lactobacillus murinus strain V10 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

atttaggattgtatttttgaactgtccctaa	CRISPR spacer
atttacgattgtctttttgaactaatcggtg	Protospacer
***** ****** **********. .*   .

170. spacer 1.39|539960|31|LR215047|PILER-CR matches to MN966730 (Vibrio phage Cilsick, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

171. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT460516 (Vibrio phage Quinn, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

172. spacer 1.39|539960|31|LR215047|PILER-CR matches to MG649967 (Vibrio virus Thalassa, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

173. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT460515 (Vibrio phage Cody, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

174. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT448616 (Vibrio phage BBMuffin, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

175. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT460514 (Vibrio phage AG74, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

176. spacer 1.39|539960|31|LR215047|PILER-CR matches to MK796244 (Vibrio phage Achelous, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

177. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT460518 (Vibrio phage Direpillow8, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

178. spacer 1.39|539960|31|LR215047|PILER-CR matches to MN966731 (Vibrio phage Chazly21, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

179. spacer 1.39|539960|31|LR215047|PILER-CR matches to MK907780 (Vibrio phage Pontus, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

180. spacer 1.39|539960|31|LR215047|PILER-CR matches to MK895508 (Vibrio phage Brizo, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

181. spacer 1.39|539960|31|LR215047|PILER-CR matches to NC_042095 (Vibrio phage Thalassa, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

182. spacer 1.39|539960|31|LR215047|PILER-CR matches to MN958086 (Vibrio phage Bennett, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

183. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT460517 (Vibrio phage Athena, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

184. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT448617 (Vibrio phage River4, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

185. spacer 1.39|539960|31|LR215047|PILER-CR matches to MT459144 (Vibrio phage Dax, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

186. spacer 1.39|539960|31|LR215047|PILER-CR matches to MN966732 (Vibrio phage Chester, complete genome) position: , mismatch: 9, identity: 0.71

taattcaaagatgataaccgtaaaaaatgag	CRISPR spacer
acgtccacagatgctaaccgtaaaaaattct	Protospacer
  .*.** ***** **************   

187. spacer 1.41|540092|32|LR215047|PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 9, identity: 0.719

ttcttaacctttcagttaattctgcaatttta	CRISPR spacer
cattaattttttcagttaattcaacaatttta	Protospacer
. .* * ..************* .********

188. spacer 1.41|540092|32|LR215047|PILER-CR matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 9, identity: 0.719

ttcttaacctttcagttaattctgcaatttta	CRISPR spacer
gcctatctttttcagttaattcttcaatctta	Protospacer
 .**   ..************** ****.***

189. spacer 1.50|540687|31|LR215047|PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 9, identity: 0.71

tggtcactataaataacttcaataaaatttt	CRISPR spacer
caacaactgtaaataactgcaataaaattgg	Protospacer
.... ***.********* **********  

190. spacer 1.50|540687|31|LR215047|PILER-CR matches to NZ_CP024793 (Nostoc flagelliforme CCNUN1 plasmid pNFSY08, complete sequence) position: , mismatch: 9, identity: 0.71

tggtcactataaataacttcaataaaatttt	CRISPR spacer
caacaactgtaaataactgcaataaaattgg	Protospacer
.... ***.********* **********  

191. spacer 1.55|541018|31|LR215047|PILER-CR matches to NC_025137 (Acinetobacter pittii strain MS32 plasmid pMS32-3, complete sequence) position: , mismatch: 9, identity: 0.71

caaaaccaggccactatatttttataaaaat	CRISPR spacer
agtcgcttcgccactaaatttttataaaaat	Protospacer
 .  .*.  ******* **************

192. spacer 1.55|541018|31|LR215047|PILER-CR matches to NZ_CP026422 (Acinetobacter sp. ACNIH1 plasmid pACI-a283, complete sequence) position: , mismatch: 9, identity: 0.71

caaaaccaggccactatatttttataaaaat	CRISPR spacer
agtggcttcgccactaaatttttataaaaat	Protospacer
 . ..*.  ******* **************

193. spacer 1.57|541150|33|LR215047|PILER-CR matches to MN013189 (Microcystis phage Mic1, complete genome) position: , mismatch: 9, identity: 0.727

ctcttaattcttttaaactgtctgctttgttga	CRISPR spacer
ttcttaattctttaaagctgtctgcggcatttt	Protospacer
.************ **.********  ..**  

194. spacer 1.41|540092|32|LR215047|PILER-CR matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 10, identity: 0.688

ttcttaacctttcagttaattctgcaatttta	CRISPR spacer
aaacaaggctttcagttaattaagcaattttt	Protospacer
   . *. *************  ******** 

195. spacer 1.41|540092|32|LR215047|PILER-CR matches to MN855768 (Siphoviridae sp. isolate 183, complete genome) position: , mismatch: 10, identity: 0.688

ttcttaacctttcagttaattctgcaatttta	CRISPR spacer
gccttatcctttcggttaattctgcgacccat	Protospacer
 .**** ******.***********.*...  

196. spacer 1.51|540753|32|LR215047|PILER-CR matches to JQ062992 (Bacillus phage phIS3501, complete genome) position: , mismatch: 10, identity: 0.688

tacgaagcttttaaagaattgaaattgataaa	CRISPR spacer
aagaggagttttaaagaatttaaattgacaat	Protospacer
 * .... ************ *******.** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 565277 : 574441 6 Mycoplasma_phage(83.33%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage