Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003047 Sinorhizobium meliloti 1021, complete genome 3 crisprs WYL,cas3,csa3 0 0 4 0
NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 3 crisprs RT,csa3 0 3 1 0
NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 0 crisprs DEDDh,csa3,RT 0 0 3 0

Results visualization

1. NC_003047
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003047_1 174959-175105 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003047_2 1131916-1132026 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003047_3 2008150-2008262 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1647299 : 1658548 12 uncultured_Mediterranean_phage(80.0%) tRNA NA
DBSCAN-SWA_2 2501868 : 2511503 6 Vibrio_phage(33.33%) NA NA
DBSCAN-SWA_3 2543264 : 2593101 46 Klosneuvirus(16.67%) transposase,tRNA,protease,holin NA
DBSCAN-SWA_4 3338256 : 3399230 46 Leptospira_phage(25.0%) integrase,transposase,tRNA attL 3345771:3345786|attR 3393130:3393145
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_003078
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003078_1 1085052-1085154 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003078_2 1085247-1085328 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003078_3 1085427-1085531 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651661-651708 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085079-1085126 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1053905-1053952 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636655-636702 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151301-1151348 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233702-233749 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644720-644767 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634529-634576 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 655818-655865 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302457-1302504 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895953-896000 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 772699-772746 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558706-558753 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292156-292203 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1423320-1423367 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373071-373118 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 795261-795308 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 658334-658381 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1225658-1225705 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998341-998388 0 1.0
NC_003078_1 1.1|1085079|48|NC_003078|CRISPRCasFinder 1085079-1085126 48 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085084-1085131 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085274-1085300 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1054100-1054126 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151496-1151522 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 656013-656039 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 772894-772920 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292351-292377 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373266-373292 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1225853-1225879 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998536-998562 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085279-1085305 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651487-651513 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636481-636507 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233528-233554 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644546-644572 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634355-634381 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302283-1302309 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895779-895805 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558532-558558 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1423146-1423172 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 795087-795113 0 1.0
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 658160-658186 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 651283-651333 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 636277-636327 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 233324-233374 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 644342-644392 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634151-634201 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302079-1302129 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895575-895625 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 558328-558378 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422942-1422992 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794883-794933 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 657956-658006 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085454-1085504 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151676-1151726 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 773074-773124 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 292531-292581 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373446-373496 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1226033-1226083 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 998716-998766 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085459-1085509 0 1.0
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 1054280-1054330 1 0.98
NC_003078_3 3.1|1085454|51|NC_003078|CRISPRCasFinder 1085454-1085504 51 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 656190-656240 1 0.98
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 778651-778677 5 0.815
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 405901-405927 5 0.815
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP049043 Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_6, complete sequence 43383-43409 5 0.815
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 MN585980 Microbacterium phage Gina, complete genome 24050-24076 5 0.815
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 MN586059 Microbacterium phage Teamocil, complete genome 24149-24175 5 0.815
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013589 Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence 341978-342004 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 339070-339096 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 345316-345342 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 353491-353517 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 339070-339096 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP013536 Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence 562461-562487 6 0.778
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 MK279840 Mycobacterium phage JacoRen57, complete genome 26434-26460 7 0.741
NC_003078_2 2.1|1085274|27|NC_003078|CRISPRCasFinder 1085274-1085300 27 NZ_CP015090 Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence 75369-75395 7 0.741

1. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

2. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

3. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

4. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

5. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

6. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

7. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

8. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

9. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

10. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

11. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

12. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

13. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

14. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

15. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

16. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

17. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

18. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

19. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

20. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

21. spacer 1.1|1085079|48|NC_003078|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	CRISPR spacer
cctccaccgcgtccggcagccaggcgacggccaacatcaccgtcggtg	Protospacer
************************************************

22. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

23. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

24. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

25. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

26. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

27. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

28. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

29. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

30. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

31. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

32. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

33. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

34. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

35. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

36. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

37. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

38. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

39. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

40. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

41. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

42. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

acggttccgacgaggcggcgggcagga	CRISPR spacer
acggttccgacgaggcggcgggcagga	Protospacer
***************************

43. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

44. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

45. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

46. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

47. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

48. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

49. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

50. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

51. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

52. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

53. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

54. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

55. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

56. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

57. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

58. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

59. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

60. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

61. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	Protospacer
***************************************************

62. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.98

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagtacagccacacgatcgatctcg	Protospacer
*****************************.*********************

63. spacer 3.1|1085454|51|NC_003078|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.98

ccggaagcagcacggccgccgaaaaagagcacagccacacgatcgatctcg	CRISPR spacer
ccggaagcagcacggccgccgaaaaagagtacagccacacgatcgatctcg	Protospacer
*****************************.*********************

64. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
tggaatccgacgaggcggcgggcacga	Protospacer
  *. ******************* **

65. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
cggcttccggcgtggcggcgggcagga	Protospacer
  * *****.** **************

66. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP049043 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_6, complete sequence) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gccgttccgagaaggcggcgggcaggt	Protospacer
.* ******* .************** 

67. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gcggctccgtcgaggcggcgggcacca	Protospacer
.***.**** **************  *

68. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 5, identity: 0.815

acggttccgacgaggcggcgggcagga	CRISPR spacer
gcggctccgtcgaggcggcgggcacca	Protospacer
.***.**** **************  *

69. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

70. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

71. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

72. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

73. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

74. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 6, identity: 0.778

acggttccgacgaggcggcgggcagga	CRISPR spacer
tcggtttcgccgaggcggcgggcaaat	Protospacer
 *****.** **************.. 

75. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to MK279840 (Mycobacterium phage JacoRen57, complete genome) position: , mismatch: 7, identity: 0.741

acggttccgacgaggcggcgggcagga	CRISPR spacer
gtacgcccgacgaggcggcggtcagga	Protospacer
...  .*************** *****

76. spacer 2.1|1085274|27|NC_003078|CRISPRCasFinder matches to NZ_CP015090 (Pelagibaca abyssi strain JLT2014 plasmid pPABY2, complete sequence) position: , mismatch: 7, identity: 0.741

acggttccgacgaggcggcgggcagga	CRISPR spacer
ttggttccggcgaggcggcgggcgtag	Protospacer
 .*******.*************. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1321480 : 1329780 10 Sinorhizobium_phage(62.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_003037
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 395729 : 404056 8 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 879858 : 904767 16 Sinorhizobium_phage(20.0%) transposase,integrase attL 901067:901081|attR 904246:904260
DBSCAN-SWA_3 1157276 : 1228765 60 Synechococcus_phage(17.65%) transposase,integrase attL 1193730:1193745|attR 1234329:1234344
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage