Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_004556 Xylella fastidiosa Temecula1, complete sequence 1 crisprs Cas9_archaeal,c2c8_V-U2,WYL,csa3,DEDDh,cas3,DinG 0 1 7 0
NC_004554 Xylella fastidiosa Temecula1 plasmid pXFPD1.3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_004556
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004556_1 1851618-1851692 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_004556_1 1.1|1851641|29|NC_004556|CRISPRCasFinder 1851641-1851669 29 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 1189005-1189033 7 0.759
NC_004556_1 1.1|1851641|29|NC_004556|CRISPRCasFinder 1851641-1851669 29 NZ_CP011248 Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence 503612-503640 7 0.759
NC_004556_1 1.1|1851641|29|NC_004556|CRISPRCasFinder 1851641-1851669 29 NZ_CP032919 Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence 774323-774351 7 0.759
NC_004556_1 1.1|1851641|29|NC_004556|CRISPRCasFinder 1851641-1851669 29 NZ_CP033029 Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence 774405-774433 7 0.759
NC_004556_1 1.1|1851641|29|NC_004556|CRISPRCasFinder 1851641-1851669 29 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 80930-80958 8 0.724

1. spacer 1.1|1851641|29|NC_004556|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ggcgtagtcgctcgttccaggtctggaag	Protospacer
  **. **.****************** .

2. spacer 1.1|1851641|29|NC_004556|CRISPRCasFinder matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

3. spacer 1.1|1851641|29|NC_004556|CRISPRCasFinder matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

4. spacer 1.1|1851641|29|NC_004556|CRISPRCasFinder matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 7, identity: 0.759

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
ccagccgttgctcgttccagggaaagatg	Protospacer
** ******************   .**..

5. spacer 1.1|1851641|29|NC_004556|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.724

cccgccgttgctcgttccaggtctggaca	CRISPR spacer
cggaacgtggctcgttccaggtctggcgc	Protospacer
*  . *** *****************   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 420334 : 469025 54 Xylella_phage(23.81%) integrase,tail,protease,capsid,plate,portal attL 450919:450933|attR 476288:476302
DBSCAN-SWA_2 1120089 : 1180387 72 Stenotrophomonas_phage(18.92%) coat,tail,transposase,protease,tRNA,head,plate NA
DBSCAN-SWA_3 1194755 : 1217907 39 Xylella_phage(31.82%) holin,terminase,integrase attL 1201189:1201206|attR 1219302:1219319
DBSCAN-SWA_4 1276042 : 1331541 71 Xylella_phage(43.18%) integrase,tail,terminase,holin,capsid,plate,portal attL 1321506:1321521|attR 1333388:1333403
DBSCAN-SWA_5 1373809 : 1397310 27 Xylella_phage(28.57%) tail,integrase,plate attL 1374281:1374295|attR 1394237:1394251
DBSCAN-SWA_6 1565807 : 1571647 10 Xylella_phage(33.33%) NA NA
DBSCAN-SWA_7 2009726 : 2018928 12 Xylella_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage