Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_004572 Tropheryma whipplei str. Twist, complete sequence 2 crisprs DEDDh 1 1 2 0

Results visualization

1. NC_004572
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004572_1 267626-267710 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004572_2 511338-511527 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_004572_1 1.1|267656|25|NC_004572|CRISPRCasFinder 267656-267680 25 NC_004572.3 268892-268916 1 0.96

1. spacer 1.1|267656|25|NC_004572|CRISPRCasFinder matches to position: 268892-268916, mismatch: 1, identity: 0.96

atgcgatatacaacccaaatagtca	CRISPR spacer
atgcgatatacaacccaaacagtca	Protospacer
*******************.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_004572_2 2.1|511375|29|NC_004572|PILER-CR 511375-511403 29 MN693998 Marine virus AFVG_250M48, complete genome 21353-21381 7 0.759
NC_004572_2 2.1|511375|29|NC_004572|PILER-CR 511375-511403 29 MN694494 Marine virus AFVG_250M305, complete genome 9647-9675 7 0.759

1. spacer 2.1|511375|29|NC_004572|PILER-CR matches to MN693998 (Marine virus AFVG_250M48, complete genome) position: , mismatch: 7, identity: 0.759

aattttgatgatgaaaggagacaaagact	CRISPR spacer
gagagagaagaagaaaggagacaaagact	Protospacer
.*    ** ** *****************

2. spacer 2.1|511375|29|NC_004572|PILER-CR matches to MN694494 (Marine virus AFVG_250M305, complete genome) position: , mismatch: 7, identity: 0.759

aattttgatgatgaaaggagacaaagact	CRISPR spacer
gtgcttgatgatgaaagtatacaaagatt	Protospacer
.  .************* * *******.*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 28321 : 35119 8 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_2 670348 : 679615 9 Indivirus(14.29%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage