Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_004943 Bifidobacterium longum NCC2705 plasmid pBLO1, complete sequence 0 crisprs NA 0 0 0 0
NC_004307 Bifidobacterium longum NCC2705, complete sequence 3 crisprs WYL,c2c9_V-U4,cas3,casR 0 1 1 0

Results visualization

1. NC_004307
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004307_1 745545-745628 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004307_2 1337044-1337128 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_004307_3 1462998-1463366 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_004307_3 3.2|1463082|24|NC_004307|CRISPRCasFinder 1463082-1463105 24 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 98015-98038 3 0.875
NC_004307_3 3.2|1463082|24|NC_004307|CRISPRCasFinder 1463082-1463105 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1789555-1789578 4 0.833

1. spacer 3.2|1463082|24|NC_004307|CRISPRCasFinder matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

ccggcagccggctgcggaaccgat	CRISPR spacer
acggctgcccgctgcggaaccgat	Protospacer
 **** *** **************

2. spacer 3.2|1463082|24|NC_004307|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

ccggcagccggctgcggaaccgat	CRISPR spacer
gaggcagccggcggcggaaccgac	Protospacer
  ********** **********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1088906 : 1153363 49 Enterobacteria_phage(30.0%) tRNA,integrase,transposase attL 1146593:1146652|attR 1154644:1155983
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage