Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003997 Bacillus anthracis str. Ames, complete sequence 5 crisprs cas3,csa3,WYL,c2c9_V-U4,cas14k,DinG,DEDDh,cas14j 0 1 10 0

Results visualization

1. NC_003997
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003997_1 1064213-1064306 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003997_2 1176596-1176704 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003997_3 2719908-2720105 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003997_4 3098200-3098334 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003997_5 3266558-3266660 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 KJ094023 Listeria phage LP-101, complete genome 3876-3902 4 0.852
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NC_022766 Bacillus phage Glittering, complete genome 9024-9050 5 0.815
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1229260-1229286 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 438058-438084 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 127169-127195 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1227597-1227623 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 850854-850880 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 513839-513865 6 0.778
NC_003997_4 4.1|3098227|27|NC_003997|CRISPRCasFinder 3098227-3098253 27 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 498252-498278 6 0.778

1. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to KJ094023 (Listeria phage LP-101, complete genome) position: , mismatch: 4, identity: 0.852

cgtctttggctcttctggtttctcttc	CRISPR spacer
catttctggctcttctggtttcttttc	Protospacer
*.*.*.*****************.***

2. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NC_022766 (Bacillus phage Glittering, complete genome) position: , mismatch: 5, identity: 0.815

cgtctttggctcttctggtttctcttc	CRISPR spacer
gttcaatggctcttctggtttctcatc	Protospacer
  **  ****************** **

3. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

4. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

5. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

6. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

7. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

8. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctat	Protospacer
*.   ******************** .

9. spacer 4.1|3098227|27|NC_003997|CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 6, identity: 0.778

cgtctttggctcttctggtttctcttc	CRISPR spacer
cagggttggctcttctggtttctctgt	Protospacer
*.   ******************** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 258542 : 266491 6 uncultured_virus(33.33%) NA NA
DBSCAN-SWA_2 297171 : 305548 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 445946 : 476616 51 Bacillus_phage(69.05%) terminase,integrase,head,protease,tail,capsid attL 450288:450303|attR 464952:464967
DBSCAN-SWA_4 480504 : 484372 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_5 1838209 : 1846942 8 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_6 2156118 : 2163242 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_7 3432225 : 3482979 55 Bacillus_phage(31.43%) terminase,portal,head,protease,tail,holin,capsid NA
DBSCAN-SWA_8 3495317 : 3506871 23 Bacillus_phage(68.42%) integrase attL 3489410:3489426|attR 3513206:3513222
DBSCAN-SWA_9 3713284 : 3789668 93 Bacillus_phage(92.59%) terminase,tRNA,portal,integrase,head,protease,tail,holin,capsid attL 3746877:3746893|attR 3791459:3791475
DBSCAN-SWA_10 4817447 : 4859679 48 Staphylococcus_phage(26.67%) terminase,tRNA,portal,head,integrase,protease,holin,capsid attL 4807824:4807839|attR 4862130:4862145
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage