Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003909 Bacillus cereus ATCC 10987, complete sequence 2 crisprs DinG,cas3,csa3,WYL,c2c9_V-U4,c2c10_CAS-V-U3,cas14k,cas14j,RT,DEDDh 0 1 7 0
NC_005707 Bacillus cereus ATCC 10987 plasmid pBc10987, complete sequence 0 crisprs RT,cas14j,csa3 0 0 0 0

Results visualization

1. NC_003909
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003909_1 1919217-1919298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003909_2 5046910-5047101 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_003909_2 2.3|5047018|24|NC_003909|CRT 5047018-5047041 24 NC_018878 Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence 270501-270524 2 0.917
NC_003909_2 2.3|5047018|24|NC_003909|CRT 5047018-5047041 24 NZ_CP014203 Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence 65429-65452 3 0.875

1. spacer 2.3|5047018|24|NC_003909|CRT matches to NC_018878 (Bacillus thuringiensis Bt407 plasmid BTB_502p, complete sequence) position: , mismatch: 2, identity: 0.917

tcaagaaccttgtccaaatcttct	CRISPR spacer
tcaagaaccttgttcaactcttct	Protospacer
*************.*** ******

2. spacer 2.3|5047018|24|NC_003909|CRT matches to NZ_CP014203 (Clostridium baratii strain CDC51267 plasmid pNPD11_1, complete sequence) position: , mismatch: 3, identity: 0.875

tcaagaaccttgtccaaatcttct	CRISPR spacer
tcaagaaccttgtcaatatcttca	Protospacer
************** * ****** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 138255 : 188228 40 Bacillus_phage(33.33%) tRNA,transposase,bacteriocin,integrase attL 150786:150802|attR 178768:178784
DBSCAN-SWA_2 338035 : 346408 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_3 367569 : 434007 66 Erysipelothrix_phage(74.42%) tail,holin,capsid,tRNA,terminase,protease,portal,head NA
DBSCAN-SWA_4 1968961 : 1978291 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_5 4172545 : 4235644 60 Klosneuvirus(22.22%) coat,tRNA,protease NA
DBSCAN-SWA_6 4314900 : 4322585 10 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_7 4697371 : 4740384 53 Prochlorococcus_phage(16.67%) protease,coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage