Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_002978 Wolbachia endosymbiont of Drosophila melanogaster, complete sequence 9 crisprs RT,DEDDh,PD-DExK,cas3 3 0 5 1

Results visualization

1. NC_002978
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_1 54484-54588 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_2 178437-178595 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_3 341228-341332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_4 403307-403411 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_5 522059-522169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_6 537321-537566 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_7 854850-854946 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_8 950540-950650 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_002978_9 1247934-1248012 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_002978_7 7.1|854874|49|NC_002978|CRISPRCasFinder 854874-854922 49 NC_002978.6 379989-380037 0 1.0
NC_002978_5 5.1|522089|51|NC_002978|CRISPRCasFinder 522089-522139 51 NC_002978.6 341291-341341 2 0.961
NC_002978_8 8.1|950570|51|NC_002978|CRISPRCasFinder 950570-950620 51 NC_002978.6 341291-341341 2 0.961

1. spacer 7.1|854874|49|NC_002978|CRISPRCasFinder matches to position: 379989-380037, mismatch: 0, identity: 1.0

tgacggtatgacggttcgcgcggtggcatgacctcgtcatcccgctact	CRISPR spacer
tgacggtatgacggttcgcgcggtggcatgacctcgtcatcccgctact	Protospacer
*************************************************

2. spacer 5.1|522089|51|NC_002978|CRISPRCasFinder matches to position: 341291-341341, mismatch: 2, identity: 0.961

tggtatgacggttaagtaattcgtcatcccgctgcttgttagcgggatcta	CRISPR spacer
tggtatgacagttaagtaattcgtcatcccgctacttgttagcgggatcta	Protospacer
*********.***********************.*****************

3. spacer 8.1|950570|51|NC_002978|CRISPRCasFinder matches to position: 341291-341341, mismatch: 2, identity: 0.961

tggtatgacggttaagtaattcgtcatcccgctgcttgttagcgggatcta	CRISPR spacer
tggtatgacagttaagtaattcgtcatcccgctacttgttagcgggatcta	Protospacer
*********.***********************.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 29212 : 132978 103 Shigella_phage(19.23%) tRNA,transposase,integrase attL 46830:46889|attR 127090:128011
DBSCAN-SWA_2 136555 : 193330 58 Shigella_phage(23.08%) tRNA,transposase,integrase attL 126289:126348|attR 198200:199058
DBSCAN-SWA_3 197425 : 391659 176 Wolbachia_phage(37.31%) capsid,head,tRNA,transposase,terminase,protease,tail,plate,integrase attL 197401:197460|attR 308704:309623
DBSCAN-SWA_4 431427 : 641027 175 Wolbachia_phage(58.02%) capsid,head,tRNA,transposase,terminase,protease,tail,plate NA
DBSCAN-SWA_5 921235 : 976186 55 Bacillus_phage(13.33%) tRNA,transposase,portal,protease NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_002978.6|WP_010962494.1|275578_276469_+|hypothetical-protein 275578_276469_+ 296 aa aa NA NA NA 197425-391659 yes