1. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.882
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgctccggattcgccgaccacgccaag Protospacer
.*************************** *.**
2. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.853
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggattcgccgaccagccccag Protospacer
********* ***************** * **
3. spacer 2.5|972060|33|NC_002977|CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.848
aagttgcggccggccgatcgcatg--ccatgacga CRISPR spacer
aagttgcggccggacggtcgcatggtccacgac-- Protospacer
************* **.******* ***.***
4. spacer 2.12|972062|33|NC_002977|PILER-CR matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.848
aagttgcggccggccgatcgcatg--ccatgacga CRISPR spacer
aagttgcggccggacggtcgcatggtccacgac-- Protospacer
************* **.******* ***.***
5. spacer 3.1|1441288|30|NC_002977|CRISPRCasFinder matches to NZ_CP013265 (Sphingobium baderi strain DE-13 plasmid pDE1, complete sequence) position: , mismatch: 5, identity: 0.833
gcggactccctccctggagtccgtccttcg CRISPR spacer
gcggactctctccctggagtcagtggatcg Protospacer
********.************ ** ***
6. spacer 1.29|682007|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.824
-ccgccacgccttacagggccttgcggatatagcg CRISPR spacer
gccgcc-cttcttccagggccttgcggatattgcc Protospacer
***** * .*** ***************** **
7. spacer 1.29|682007|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.824
-ccgccacgccttacagggccttgcggatatagcg CRISPR spacer
gccgcc-cttcttccagggccttgcggatattgcc Protospacer
***** * .*** ***************** **
8. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
acttgcccgatccggattcgccgaccagcgccaa Protospacer
******** ***************** ** *.
9. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgaccagcccaag Protospacer
********* **************** *.**
10. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggattcgccgacgagccccag Protospacer
********* *************** * * **
11. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggattcgccgacgagaccgac Protospacer
********* *************** * . ***
12. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgaccagcccaag Protospacer
********* **************** *.**
13. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgaaccggattcgccgaccacggccac Protospacer
.******* ******************** *
14. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgaaccggattcgccgaccacggccac Protospacer
.******* ******************** *
15. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgtaccggattcgccgaccacgcaaac Protospacer
*********. ****************** .*
16. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
acttgcccgatccggattcgccgaccagacccag Protospacer
******** ***************** . * **
17. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgaaccggattcgccgaccagcgcaac Protospacer
********* **************** **.*
18. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggattccccgaccagcccgac Protospacer
********* ********* ******* ***
19. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgacccggattcgccgaccagccccag Protospacer
********* .**************** * **
20. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgaccagccccag Protospacer
********* **************** * **
21. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 6, identity: 0.824
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatcccgattcgccgaccagccccag Protospacer
********* *** ************* * **
22. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MG592515 (Vibrio phage 1.144.O._10N.286.45.B3, partial genome) position: , mismatch: 6, identity: 0.833
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
tgcaacaccaccaccaccaccaccaccggccgcaaa Protospacer
*.* * *****************.****** ****
23. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to MT855965 (Microcystis phage vB_MaeS-yong1, complete genome) position: , mismatch: 6, identity: 0.818
ccggtgaggcggaagccgcagacg--gtccagccg CRISPR spacer
ccggcgacgcggaagccgcagacgtcctccatc-- Protospacer
****.** **************** **** *
24. spacer 2.8|971818|33|NC_002977|PILER-CR matches to MT855965 (Microcystis phage vB_MaeS-yong1, complete genome) position: , mismatch: 6, identity: 0.818
ccggtgaggcggaagccgcagacg--gtccagccg CRISPR spacer
ccggcgacgcggaagccgcagacgtcctccatc-- Protospacer
****.** **************** **** *
25. spacer 1.8|680496|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
agaatacgattccaatggtaatttaatttattat CRISPR spacer
aaaataggattccaattgtaatttaatgctttgt Protospacer
*.**** ********* ********** . **.*
26. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010057 (Hymenobacter sp. DG25B plasmid, complete sequence) position: , mismatch: 7, identity: 0.794
gagtccaggcgctcggcaatgggccgccggatga- CRISPR spacer
gagtcgaggcgctcggcaatgggct-ccaactcac Protospacer
***** ******************. **.. * *
27. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.794
gagtccaggcgctcggcaatgggccgccggatga- CRISPR spacer
gagtccagccgctcagcaatgggct-ccagctcac Protospacer
******** *****.*********. **.* * *
28. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
29. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggattcaccgacgagaccgac Protospacer
********* *********.***** * . ***
30. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
31. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgctac Protospacer
********* ************** *. ** *
32. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
acttgcccgatccggattcgcctaccaacccgaa Protospacer
******** ************ **** ***.
33. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgccggatccggattcgccgacaatgccaat Protospacer
******* * *************** *.* *.*
34. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgaaccggattcgccgaccagccccat Protospacer
********* **************** * *
35. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccggactcgccgaccagacccat Protospacer
********* ******.********** . * *
36. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
37. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
38. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
39. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
40. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
41. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
42. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
43. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
44. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
45. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
46. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
47. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
48. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
49. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
50. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
51. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
52. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
53. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
54. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
55. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgctac Protospacer
********* ************** *. ** *
56. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
57. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
58. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
59. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
60. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
61. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
62. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
63. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
64. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
65. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgacccggattcgccgacgatcgccac Protospacer
********* .************** *. ** *
66. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
67. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
68. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
69. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
70. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgaaccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
71. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgctac Protospacer
********* ************** *. ** *
72. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ttttgccggatccggattcgccgaccagcgcatg Protospacer
*.***** * ***************** **. *
73. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
74. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014127 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ttttgccggatccggattcgccgaccagcgcatg Protospacer
*.***** * ***************** **. *
75. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
76. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgacccggattcgccgacgatcgccac Protospacer
********* .************** *. ** *
77. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacaatcgccac Protospacer
********* ************** *. ** *
78. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028350 (Pantoea vagans strain PV989 plasmid pPV989-508, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ttttgccggatccggattcgccgaccagcgcatg Protospacer
*.***** * ***************** **. *
79. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ttttgcccgcgccggattctccgaccagcccgac Protospacer
*.******** ******** ******* ***
80. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ttttgccggatccggattcgccgaccagcgcatg Protospacer
*.***** * ***************** **. *
81. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgacccggattcgccgacgatcgccac Protospacer
********* .************** *. ** *
82. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.794
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgagccggattcgccgacgatcgccac Protospacer
********* ************** *. ** *
83. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
84. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
85. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
86. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
ccggtgcggccgaagccgcagacgacctcgtcg Protospacer
****** *** *************..*. *.**
87. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
88. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
89. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
90. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
91. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
ccggtgcggccgaagccgcagacgacctcgtcg Protospacer
****** *** *************..*. *.**
92. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 7, identity: 0.788
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
cctgtccctcgcaagccacagacggtccagccg Protospacer
** ** ** *****.***************
93. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX009059 (Pseudomonas syringae pv. actinidiae strain RT685 plasmid pMG1_RT685, complete sequence) position: , mismatch: 8, identity: 0.765
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
ctcggtgccgcccctgatccagctccagatctgc Protospacer
*.************ ************* .
94. spacer 1.15|680998|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ccatggcttccgccaccttggtcactccgccgaa---- CRISPR spacer
ccatggcttccgtcacctcggtcat----acgaatctt Protospacer
************.*****.*****. ****
95. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.765
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
acttgcccgagccggattcgccgacgataccgac Protospacer
******** ************** *.. ***
96. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 8, identity: 0.765
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgatccggattcgcccaccatgcagac Protospacer
.******* ************ ****.* **
97. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.765
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgacccggattcgccgaccagcccgac Protospacer
.******* .**************** ***
98. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 8, identity: 0.765
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
acttgcccgaaccggattcgccgacgatgccaat Protospacer
******** ************** *.* *.*
99. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021817 (Sinorhizobium meliloti strain M270 plasmid accessoryC, complete sequence) position: , mismatch: 8, identity: 0.765
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
atttgcccgatccggattcaccgaccaggcagac Protospacer
.******* *********.******* * **
100. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MK359360 (Mycobacterium phage Hexamo, complete genome) position: , mismatch: 8, identity: 0.778
--ggtatcc-ccaccaccaccaccaccgccggccccaaa CRISPR spacer
ctgctgtccaccaccaccaccaccgccgccgccgcc--- Protospacer
* *.*** **************.****** * **
101. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.758
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
tcaactgccgcgtgagctgcgagatgcctccct Protospacer
**********.********* **** . .**
102. spacer 2.11|972001|33|NC_002977|PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.758
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
tcaactgccgcgtgagctgcgagatgcctccct Protospacer
**********.********* **** . .**
103. spacer 1.3|680135|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
atggcggcggtcatgcctggcgcgccgccggcctg CRISPR spacer
tcttccaccgtcacgccttgcgcgccgccggcctg Protospacer
. * .* ****.**** ****************
104. spacer 1.3|680135|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
atggcggcggtcatgcctggcgcgccgccggcctg CRISPR spacer
tcttccaccgtcacgccttgcgcgccgccggcctg Protospacer
. * .* ****.**** ****************
105. spacer 1.3|680135|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.743
atggcggcggtcatgcctggcgcgccgccggcctg CRISPR spacer
tcttccaccgtcacgccttgcgcgccgccggcctg Protospacer
. * .* ****.**** ****************
106. spacer 1.3|680135|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.743
atggcggcggtcatgcctggcgcgccgccggcctg CRISPR spacer
tcttccaccgtcacgccttgcgcgccgccggcctg Protospacer
. * .* ****.**** ****************
107. spacer 1.3|680135|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.743
atggcggcggtcatgcctggcgcgccgccggcctg CRISPR spacer
tcttccaccgtcacgccttgcgcgccgccggcctg Protospacer
. * .* ****.**** ****************
108. spacer 1.15|680998|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.735
ccatggcttccgccaccttggtcactccgccgaa CRISPR spacer
cgccgcccgccgccaccttggtcacggcgccgac Protospacer
* .* *. **************** ******
109. spacer 1.15|680998|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 9, identity: 0.735
ccatggcttccgccaccttggtcactccgccgaa---- CRISPR spacer
ccatggcttccgtcacctcggtcat----gcgagtctt Protospacer
************.*****.*****. ***.
110. spacer 1.20|681361|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.735
attcggcgctgaagccggttttcctctggatcat CRISPR spacer
tttcggcgctgaagctggatttcctcggcgttcg Protospacer
**************.** ******* * .*.
111. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049040 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_3, complete sequence) position: , mismatch: 9, identity: 0.735
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
tcttgcccgatccgtattcgccgatgatgaaccg Protospacer
********* **** *********. *.*. *
112. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MK494121 (Gordonia phage Nimi13, complete genome) position: , mismatch: 9, identity: 0.75
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
actccccccaccaccaccaccaccaccggcaccgtc Protospacer
. * .*******************.***** **.
113. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049160 (Caballeronia sp. SBC1 plasmid pSBC1_4, complete sequence) position: , mismatch: 9, identity: 0.75
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
tgcgcccccaccaccaccaccaccgccgccgccgcc Protospacer
*...*********************** * **.
114. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_014642 (Achromobacter xylosoxidans A8 plasmid pA82, complete sequence) position: , mismatch: 9, identity: 0.75
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
gtcgccgccaccaccaccaccaccgccgccgccgca Protospacer
* ...* ********************* * **. *
115. spacer 2.1|971816|33|NC_002977|CRISPRCasFinder,CRT matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 9, identity: 0.727
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
caatcgagccggaagccgcagacgttccacgcc Protospacer
* . .*** *************** **** *
116. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MN813678 (Mycobacterium phage Lephleur, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
117. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MK814751 (Mycobacterium phage Bananafish, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
118. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to KM101117 (Mycobacterium phage LizLemon, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
119. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to NC_043767 (Mycobacterium virus TA17a, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
120. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MT639652 (Mycobacterium phage MasterPo, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
121. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MG812491 (Mycobacterium phage ItsyBitsy1, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
122. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgagggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
123. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to JN618996 (Mycobacterium phage Arbiter, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
124. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
125. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MK061411 (Mycobacterium phage Faze9, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
126. spacer 2.5|972060|33|NC_002977|CRISPRCasFinder,CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.727
aagttgcggccggccgatcgcatgccatgacga CRISPR spacer
gcatgccggccggccgctcgcctgccatgaagg Protospacer
. .* ********** **** ******** *.
127. spacer 2.8|971818|33|NC_002977|PILER-CR matches to NZ_CP039924 (Agrobacterium tumefaciens strain CFBP7129 plasmid pAtCFBP7129a, complete sequence) position: , mismatch: 9, identity: 0.727
ccggtgaggcggaagccgcagacggtccagccg CRISPR spacer
caatcgagccggaagccgcagacgttccacgcc Protospacer
* . .*** *************** **** *
128. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MN813678 (Mycobacterium phage Lephleur, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
129. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MK814751 (Mycobacterium phage Bananafish, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
130. spacer 2.11|972001|33|NC_002977|PILER-CR matches to KM101117 (Mycobacterium phage LizLemon, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
131. spacer 2.11|972001|33|NC_002977|PILER-CR matches to NC_043767 (Mycobacterium virus TA17a, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
132. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MT639652 (Mycobacterium phage MasterPo, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
133. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MG812491 (Mycobacterium phage ItsyBitsy1, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
134. spacer 2.11|972001|33|NC_002977|PILER-CR matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgagggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
135. spacer 2.11|972001|33|NC_002977|PILER-CR matches to JN618996 (Mycobacterium phage Arbiter, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
136. spacer 2.11|972001|33|NC_002977|PILER-CR matches to KX443696 (Mycobacterium phage Laurie, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
137. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MK061411 (Mycobacterium phage Faze9, complete genome) position: , mismatch: 9, identity: 0.727
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggccgaaggcatgagctgcgcgatggtgaccg Protospacer
* . * . *******************. ***
138. spacer 2.12|972062|33|NC_002977|PILER-CR matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 9, identity: 0.727
aagttgcggccggccgatcgcatgccatgacga CRISPR spacer
gcatgccggccggccgctcgcctgccatgaagg Protospacer
. .* ********** **** ******** *.
139. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
gcaccagccgcccctgcgccagctccgcatcagc Protospacer
* ********************. ***..
140. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 10, identity: 0.706
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
gggcttcggaccgctgcgcccgctccagatcgag Protospacer
*. * .** ******* *************
141. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018666 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_3, complete sequence) position: , mismatch: 10, identity: 0.706
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
gggcttcggaccgctgcgcccgctccagatcgag Protospacer
*. * .** ******* *************
142. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013265 (Sphingobium baderi strain DE-13 plasmid pDE1, complete sequence) position: , mismatch: 10, identity: 0.706
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
gggcttcggaccgctgcgcccgctccagatcgag Protospacer
*. * .** ******* *************
143. spacer 1.14|680927|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 10, identity: 0.706
gacagtgccgcccctgcgccagctccagatcgag CRISPR spacer
tgttaagctccccctgctccagctccagttcgag Protospacer
.. . **. ******* ********** *****
144. spacer 1.17|681141|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 10, identity: 0.722
ttgcccacaattacaaccatggttgacagcctcact CRISPR spacer
gtattaacaattacaacgatggttgacagactgtca Protospacer
*... *********** *********** ** *
145. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
146. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
147. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
148. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
149. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
150. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
151. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
152. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
153. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
154. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
155. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
156. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
157. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
158. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
159. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
160. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
161. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
162. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
163. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
164. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
165. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
166. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
167. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
168. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
cgaggcaggcgcacggcaattggccgccggctac Protospacer
.. ******* ******* ********* *.
169. spacer 1.21|681432|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 10, identity: 0.706
gagtccaggcgctcggcaatgggccgccggatga CRISPR spacer
ggttccaggccctcggcaatggtccgcgccttcg Protospacer
*. ******* *********** **** * .
170. spacer 1.31|682153|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.706
tcttgcccgctccggattcgccgaccacggcgag CRISPR spacer
ggctggaggcgccggatacgccgaccacggcgca Protospacer
.** ** ****** ************** .
171. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MN694665 (Marine virus AFVG_250M495, complete genome) position: , mismatch: 10, identity: 0.722
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
aaaaataccaccaccaccaccaccgccagcaccagc Protospacer
.. * . ********************.** ***.
172. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to CP003954 (Rhodococcus opacus PD630 plasmid 5, complete sequence) position: , mismatch: 10, identity: 0.722
ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
ccgctacgcaccaccaccaccaccgccgtcaccacc Protospacer
* * ******************** * ***
173. spacer 1.42|682942|34|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041162 (Leisingera aquaemixtae strain R2C4 plasmid unnamed6) position: , mismatch: 10, identity: 0.706
tgaggagacttggaccggtcgcgggattgcccct CRISPR spacer
atttcagaattggacctgtcgcgggattgtgccg Protospacer
*** ******* ************. **
174. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MG812490 (Mycobacterium phage Holeinone, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
175. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MH051249 (Mycobacterium phage Boyle, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
176. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MN428049 (Mycobacterium phage West99, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
177. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MN586045 (Mycobacterium phage Brownie5, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
178. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MH001452 (Mycobacterium phage Kheth, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
179. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MH697584 (Mycobacterium phage FrenchFry, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
180. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MG757162 (Mycobacterium phage Opia, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
181. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to KT365402 (Mycobacterium phage Tres, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
182. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to JN698991 (Mycobacterium phage Hedgerow, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
183. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MN586046 (Mycobacterium phage Tinciduntsolum, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
184. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MK620898 (Mycobacterium phage Coffee, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
185. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to JN699004 (Mycobacterium phage Ares, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
186. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MN234225 (Mycobacterium phage Rhinoforte, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
187. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to DQ398048 (Mycobacterium phage Qyrzula, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
188. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to AY129334 (Mycobacterium phage Rosebush, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
189. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MH590591 (Mycobacterium phage Sabella, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
190. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
191. spacer 2.4|971999|33|NC_002977|CRISPRCasFinder,CRT matches to KT880194 (Mycobacterium phage Glass, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
192. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MG812490 (Mycobacterium phage Holeinone, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
193. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MH051249 (Mycobacterium phage Boyle, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
194. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MN428049 (Mycobacterium phage West99, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
195. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MN586045 (Mycobacterium phage Brownie5, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
196. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MH001452 (Mycobacterium phage Kheth, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
197. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MH697584 (Mycobacterium phage FrenchFry, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
198. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MG757162 (Mycobacterium phage Opia, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
199. spacer 2.11|972001|33|NC_002977|PILER-CR matches to KT365402 (Mycobacterium phage Tres, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
200. spacer 2.11|972001|33|NC_002977|PILER-CR matches to JN698991 (Mycobacterium phage Hedgerow, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
201. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MN586046 (Mycobacterium phage Tinciduntsolum, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
202. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MK620898 (Mycobacterium phage Coffee, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
203. spacer 2.11|972001|33|NC_002977|PILER-CR matches to JN699004 (Mycobacterium phage Ares, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
204. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MN234225 (Mycobacterium phage Rhinoforte, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
205. spacer 2.11|972001|33|NC_002977|PILER-CR matches to DQ398048 (Mycobacterium phage Qyrzula, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
206. spacer 2.11|972001|33|NC_002977|PILER-CR matches to AY129334 (Mycobacterium phage Rosebush, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
207. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MH590591 (Mycobacterium phage Sabella, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
208. spacer 2.11|972001|33|NC_002977|PILER-CR matches to MH727546 (Mycobacterium phage Eaglehorse, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
209. spacer 2.11|972001|33|NC_002977|PILER-CR matches to KT880194 (Mycobacterium phage Glass, complete genome) position: , mismatch: 10, identity: 0.697
gcaactgccgcatgagctgcgcgatggtatccg CRISPR spacer
gggctgaaggcatgagctgcgcgatggtgaccg Protospacer
* . . . *******************. ***
210. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038272 (Legionella geestiana strain 1308 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.694
---ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
caatacaccaccaccaccaccaccgccgccgccacc--- Protospacer
..*.* **************.****** * **
211. spacer 1.54|683806|35|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.686
aagggcggcggtcatcgcgggccgccgcgaatagc CRISPR spacer
tatggcggcggtcatggccggccgccgccttggtt Protospacer
* ************ ** ********* . .
212. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MT986025 (Gordonia phage GrootJr, complete genome) position: , mismatch: 12, identity: 0.667
ggtatccccaccaccaccaccaccgccggccccaaa--- CRISPR spacer
---gcgtccaccaccaccaccaccaccgccgccaccgtc Protospacer
.. .*****************.*** * ***
213. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MT889393 (Gordonia phage NovumRegina, complete genome) position: , mismatch: 12, identity: 0.667
ggtatccccaccaccaccaccaccgccggccccaaa--- CRISPR spacer
---gcgtccaccaccaccaccaccaccgccgccaccgtc Protospacer
.. .*****************.*** * ***
214. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to KF560333 (Mycobacterium phage Artemis2UCLA, complete genome) position: , mismatch: 13, identity: 0.639
---ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
ctgtccaccaccaccaccaccaccgccgccgccgtt--- Protospacer
.*.* **************.****** * ..
215. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to MG099945 (Mycobacterium phage Koko, complete genome) position: , mismatch: 13, identity: 0.639
---ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
ctgtccaccaccaccaccaccaccgccgccgccgtt--- Protospacer
.*.* **************.****** * ..
216. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 14, identity: 0.611
------ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
ccgtggaccaccaccaccaccaccgccgccgccgac------ Protospacer
. .*.* ***********.**.******.*
217. spacer 1.35|682440|36|NC_002977|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 14, identity: 0.611
------ggtatccccaccaccaccaccaccgccggccccaaa CRISPR spacer
ccgtggaccaccaccaccaccaccgccgccgccgac------ Protospacer
. .*.* ***********.**.******.*
