1. spacer 1.39|42160|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 3, identity: 0.9
aatatcttctcttgttgtatatcattcgtc CRISPR spacer
tacatcttctcttgttgtatatcattcatc Protospacer
*.************************.**
2. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP053971 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
3. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP039724 (Bacillus thuringiensis strain BT-59 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
4. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013278 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-3-235K, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
5. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NC_018509 (Bacillus thuringiensis HD-789 plasmid pBTHD789-2, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
6. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP051859 (Bacillus thuringiensis serovar israelensis strain BGSC 4Q7rifR plasmid pBtic235, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
7. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP009347 (Bacillus thuringiensis HD1002 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
8. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045025 (Bacillus thuringiensis strain JW-1 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.867
atattatagttagtagtttcttctttattc CRISPR spacer
aaattaaagttagtagattcttctttatta Protospacer
* **** ********* ************
9. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NC_014749 (Calditerrivibrio nitroreducens DSM 19672 plasmid pCALNI01, complete sequence) position: , mismatch: 5, identity: 0.833
tattaagtgtagataaaaaattatctttaa CRISPR spacer
tattaagttttgataaaaaattatatctta Protospacer
******** * ************* *.* *
10. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP017969 (Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-1, complete sequence) position: , mismatch: 5, identity: 0.833
aattactacataatggaaaatcaaatcaaa CRISPR spacer
aatttctacataatggaaagtcaaaaaata Protospacer
**** **************.***** * *
11. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035412 (Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
12. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028216 (Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
13. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045822 (Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
14. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045813 (Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
15. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP041758 (Bacillus sp. KBS0812 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
16. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP030938 (Bacillus sp. DM2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
17. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NC_021809 (Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
18. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP020103 (Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
19. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP019715 (Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
20. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NC_015149 (Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
21. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP034485 (Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
22. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045923 (Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
23. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LN831028 (Fusobacterium nucleatum subsp. polymorphum strain NCTC10562 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.833
aaaagaagaatgagattttttactaaatga CRISPR spacer
agaagaagaattagatttttaactaaaaaa Protospacer
*.********* ******** ****** .*
24. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080596 (UNVERIFIED: Staphylococcus phage vB_SauM_EW42, complete genome) position: , mismatch: 5, identity: 0.833
gatta--gtagataacgtaattaaagtagtaa CRISPR spacer
--ttaatgtagataacagaattaaagtagtag Protospacer
*** *********. *************.
25. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080593 (UNVERIFIED: Staphylococcus phage vB_SauM_EW36, complete genome) position: , mismatch: 5, identity: 0.833
gatta--gtagataacgtaattaaagtagtaa CRISPR spacer
--ttaatgtagataacagaattaaagtagtag Protospacer
*** *********. *************.
26. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693189 (Marine virus AFVG_25M326, complete genome) position: , mismatch: 5, identity: 0.833
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
gtattagataaatctaaatttgcatttaca Protospacer
..****.*.******************* *
27. spacer 1.27|41368|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_018265 (Melissococcus plutonius DAT561 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
tgaaacaagtccagtcgataaag--gaaatga CRISPR spacer
tgaaacaagtgcagtcgctaaagctgcaat-- Protospacer
********** ****** ***** * ***
28. spacer 1.27|41368|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006684 (Melissococcus plutonius S1 plasmid pMEPL_178, complete sequence) position: , mismatch: 5, identity: 0.833
tgaaacaagtccagtcgataaag--gaaatga CRISPR spacer
tgaaacaagtgcagtcgctaaagctgcaat-- Protospacer
********** ****** ***** * ***
29. spacer 1.27|41368|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP021886 (Melissococcus plutonius strain DAT1033 plasmid pMP1, complete sequence) position: , mismatch: 5, identity: 0.833
tgaaacaagtccagtcgataaag--gaaatga CRISPR spacer
tgaaacaagtgcagtcgctaaagctgcaat-- Protospacer
********** ****** ***** * ***
30. spacer 1.27|41368|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018525 (Melissococcus plutonius strain DAT585 plasmid pMP1, complete sequence) position: , mismatch: 5, identity: 0.833
tgaaacaagtccagtcgataaag--gaaatga CRISPR spacer
tgaaacaagtgcagtcgctaaagctgcaat-- Protospacer
********** ****** ***** * ***
31. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 5, identity: 0.833
tcattgtataatctttttttcaatttgtat CRISPR spacer
ttgttgtatcatctttttttgaatttgttt Protospacer
*..****** ********** ******* *
32. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 5, identity: 0.833
tcattg-tataatctttttttcaatttgtat CRISPR spacer
-ggttgctataatctctttttcagtttgtat Protospacer
.*** ********.*******.*******
33. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 5, identity: 0.833
tcattg--tataatctttttttcaatttgtat CRISPR spacer
--attagttataaactttttttcaatttttat Protospacer
***. ***** ************** ***
34. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035412 (Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
35. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028216 (Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
36. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP030938 (Bacillus sp. DM2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
37. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP019715 (Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
38. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045822 (Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
39. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045813 (Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
40. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP041758 (Bacillus sp. KBS0812 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
41. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NC_021809 (Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
42. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP020103 (Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
43. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NC_015149 (Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
44. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP034485 (Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
45. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045923 (Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence) position: , mismatch: 5, identity: 0.833
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
**.*.* ************* ********
46. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_011785 (Borreliella burgdorferi ZS7 plasmid ZS7_lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
47. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_018993 (Borrelia burgdorferi 297 plasmid 297_lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
48. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017407 (Borreliella burgdorferi JD1 plasmid JD1 lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
49. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017416 (Borreliella burgdorferi N40 plasmid N40_lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
50. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP031403 (Borreliella burgdorferi strain MM1 plasmid plsm_lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
51. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_001854 (Borreliella burgdorferi B31 plasmid lp28-4, complete sequence) position: , mismatch: 5, identity: 0.833
atatattattatactatcaaaataatacat CRISPR spacer
agctcttattagactatcaaaataatacaa Protospacer
* * ****** *****************
52. spacer 1.34|41830|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028100 (Synechocystis sp. IPPAS B-1465 plasmid pSYSX, complete sequence) position: , mismatch: 5, identity: 0.833
aatattagagcagtaaaattaagtatttat CRISPR spacer
ggtattaaatcagtaaaattaagtatttag Protospacer
..*****.* *******************
53. spacer 1.34|41830|30|NC_006908|CRISPRCasFinder,CRT matches to NC_005232 (Synechocystis sp. PCC 6803 plasmid pSYSX, complete sequence) position: , mismatch: 5, identity: 0.833
aatattagagcagtaaaattaagtatttat CRISPR spacer
ggtattaaatcagtaaaattaagtatttag Protospacer
..*****.* *******************
54. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT926124 (Staphylococcus phage vB_SauP_EBHT, complete genome) position: , mismatch: 5, identity: 0.833
caatgcaacactatttggaaaa--tgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttggttt-- Protospacer
********* *********** **.***
55. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KJ210330 (Staphylococcus phage GRCS, complete genome) position: , mismatch: 5, identity: 0.833
caatgcaacactatttggaaaa--tgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttggttt-- Protospacer
********* *********** **.***
56. spacer 1.54|43150|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693128 (Marine virus AFVG_25M106, complete genome) position: , mismatch: 5, identity: 0.833
tcacgaagttttatgaaaagaaattgaaaa CRISPR spacer
taaaaaagttttaaaaaaagaaattgaaaa Protospacer
* * .******** .***************
57. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NC_014749 (Calditerrivibrio nitroreducens DSM 19672 plasmid pCALNI01, complete sequence) position: , mismatch: 5, identity: 0.833
tattaagtgtagataaaaaattatctttaa CRISPR spacer
tattaagttttgataaaaaattatatctta Protospacer
******** * ************* *.* *
58. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NZ_AP017969 (Fusobacterium varium strain Fv113-g1 plasmid pFV113-g1-1, complete sequence) position: , mismatch: 5, identity: 0.833
aattactacataatggaaaatcaaatcaaa CRISPR spacer
aatttctacataatggaaagtcaaaaaata Protospacer
**** **************.***** * *
59. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP035412 (Bacillus subtilis strain SRCM103622 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
60. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP028216 (Bacillus subtilis strain SRCM102750 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
61. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP045822 (Bacillus subtilis strain MB8_B7 plasmid pBs001, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
62. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP045813 (Bacillus subtilis strain P8_B3 plasmid pBs005, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
63. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP041758 (Bacillus sp. KBS0812 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
64. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP030938 (Bacillus sp. DM2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
65. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NC_021809 (Bacillus subtilis subsp. subtilis str. NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
66. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP020103 (Bacillus subtilis strain NCIB 3610 plasmid pBS32, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
67. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_AP019715 (Bacillus subtilis subsp. subtilis strain NBRC 13719 plasmid pBSU1, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
68. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NC_015149 (Bacillus subtilis subsp. natto plasmid pLS32 DNA, complete sequence, strain: IAM 11631) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
69. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP034485 (Bacillus subtilis subsp. subtilis NCIB 3610 = ATCC 6051 strain NCIB 3610 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
70. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP045923 (Bacillus subtilis strain P8_B1 plasmid pBs003, complete sequence) position: , mismatch: 5, identity: 0.833
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--gaccgactccttattataaaattgaaattt Protospacer
****.. ************* ********
71. spacer 1.76|40512|30|NC_006908|PILER-CR matches to NZ_LN831028 (Fusobacterium nucleatum subsp. polymorphum strain NCTC10562 plasmid 2, complete sequence) position: , mismatch: 5, identity: 0.833
aaaagaagaatgagattttttactaaatga CRISPR spacer
agaagaagaattagatttttaactaaaaaa Protospacer
*.********* ******** ****** .*
72. spacer 1.4|39851|30|NC_006908|CRISPRCasFinder,CRT matches to MT457553 (Shewanella phage Thanatos-2, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
73. spacer 1.4|39851|30|NC_006908|CRISPRCasFinder,CRT matches to MT457552 (Shewanella phage Thanatos-1, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
74. spacer 1.5|39917|30|NC_006908|CRISPRCasFinder,CRT matches to KF114877 (Leptospira phage LnoZ_CZ214, complete genome) position: , mismatch: 6, identity: 0.8
tgaatctcttcttcgtttaatgtatcacgt CRISPR spacer
tgaaactcttcttcgtttaatgtaacgata Protospacer
**** ******************* *.
75. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897276 (Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
76. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897280 (Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
77. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897275 (Clostridium botulinum strain IFR 12/29 plasmid p12/29, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
78. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897277 (Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
79. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897278 (Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
80. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897279 (Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
81. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019367 (Borrelia turicatae 91E135 isolate Oz1 plasmid lpG29, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
atcttttagaatctgatattaatttctcat Protospacer
** ********* ************. *
82. spacer 1.9|40181|30|NC_006908|CRISPRCasFinder,CRT matches to MT457553 (Shewanella phage Thanatos-2, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
83. spacer 1.9|40181|30|NC_006908|CRISPRCasFinder,CRT matches to MT457552 (Shewanella phage Thanatos-1, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
84. spacer 1.10|40247|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaggttatacagttgctttaaatactta CRISPR spacer
agtaggttatacagttgttttaaataggat Protospacer
****************.********
85. spacer 1.10|40247|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaggttatacagttgctttaaatactta CRISPR spacer
agtaggttatacagttgttttaaataggat Protospacer
****************.********
86. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP020096 (Lactobacillus plantarum strain K25 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
87. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028245 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
88. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
89. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
90. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035398 (Bacillus subtilis strain SRCM103773 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.***.. ************* ********
91. spacer 1.12|40379|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP010015 (Bacillus sp. YP1 plasmid pBUYP1, complete sequence) position: , mismatch: 6, identity: 0.8
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.***.. ************* ********
92. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
tttaattttgcgctatctttaattttttta CRISPR spacer
ttttcaattgcgctttctttaatttttgta Protospacer
*** ******* ************ **
93. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
tttaattttgcgctatctttaattttttta CRISPR spacer
ttttcaattgcgctttctttaatttttgta Protospacer
*** ******* ************ **
94. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP040803 (Streptococcus salivarius strain LAB813 plasmid pSAL813, complete sequence) position: , mismatch: 6, identity: 0.8
---tttaattttgcgctatctttaattttttta CRISPR spacer
gagtt---ttttgcgctatttttaatgtttttt Protospacer
** ***********.****** *****
95. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 6, identity: 0.8
tttaa---ttttgcgctatctttaattttttta CRISPR spacer
---aagtcttttgcgttatctttaatttcttga Protospacer
** *******.************.** *
96. spacer 1.16|40643|29|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP012423 (Spiroplasma kunkelii CR2-3x plasmid pSKU226, complete sequence) position: , mismatch: 6, identity: 0.793
ctgcaggacaaataactttaagaaataca CRISPR spacer
atcatcgacaaacaactttaagaaataca Protospacer
* ******.****************
97. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 6, identity: 0.8
tgacgaaactcattcatatcaatacctttt CRISPR spacer
tgtttaaactgattcaaatcaataccttta Protospacer
** . ***** ***** ************
98. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 6, identity: 0.8
tgacgaaactcattcatatcaatacctttt CRISPR spacer
tgtttaaactgattcaaatcaataccttta Protospacer
** . ***** ***** ************
99. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 6, identity: 0.8
tgacgaaactcattcatatcaatacctttt CRISPR spacer
tgtttaaactgattcaaatcaataccttta Protospacer
** . ***** ***** ************
100. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 6, identity: 0.8
tgacgaaactcattcatatcaatacctttt CRISPR spacer
tgtttaaactgattcaaatcaataccttta Protospacer
** . ***** ***** ************
101. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 6, identity: 0.8
tgacgaaactcattcatatcaatacctttt CRISPR spacer
tgtttaaactgattcaaatcaataccttta Protospacer
** . ***** ***** ************
102. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to JQ680349 (Unidentified phage clone 1013_scaffold24 genomic sequence) position: , mismatch: 6, identity: 0.8
gattagtagataacgtaattaaagtagtaa CRISPR spacer
cattagaagataacgtaattacagtacgta Protospacer
***** ************** **** *
103. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KX011028 (Staphylococcus phage pSco-10, complete genome) position: , mismatch: 6, identity: 0.8
gatta--gtagataacgtaattaaagtagtaa CRISPR spacer
--tcaatgtagataacagaattaaagtagtag Protospacer
*.* *********. *************.
104. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014852 (Bacillus thuringiensis strain HD12 plasmid pHD120161, complete sequence) position: , mismatch: 6, identity: 0.8
cgaattaaatgcagaagttattgcaattaa CRISPR spacer
ggaattaaatgcagaagatattgcagaaag Protospacer
**************** *******. *.
105. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_018487 (Bacillus thuringiensis HD-771 plasmid p03, complete sequence) position: , mismatch: 6, identity: 0.8
cgaattaaatgcagaagttattgcaattaa CRISPR spacer
ggaattaaatgcagaagatattgcagaaag Protospacer
**************** *******. *.
106. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
cgaattaaatgcagaagttattgcaattaa--- CRISPR spacer
cgcattaaatgcagaagttat---aactgagtt Protospacer
** ****************** **.*.*
107. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP042875 (Bacillus cereus strain 09 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tcattgtataatctttttttcaatttgtat CRISPR spacer
caaatgtataatattttttacaatttgtaa Protospacer
. * ******** ****** *********
108. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to KJ608188 (Enterococcus phage EFC-1, complete genome) position: , mismatch: 6, identity: 0.8
tcattgtataatctttttttcaatttgtat- CRISPR spacer
ggattgtataatatttttttcga-ttgtacc Protospacer
********** ********.* *****.
109. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP035398 (Bacillus subtilis strain SRCM103773 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.*.*.* ************* ********
110. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP010015 (Bacillus sp. YP1 plasmid pBUYP1, complete sequence) position: , mismatch: 6, identity: 0.8
cagatcaa--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.*.*.* ************* ********
111. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to MN693405 (Marine virus AFVG_25M416, complete genome) position: , mismatch: 6, identity: 0.8
cccacaatttattacaagaaataataaaca CRISPR spacer
atgataatttaaaacaagaaataataaaca Protospacer
. *.****** *****************
112. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to MN693333 (Marine virus AFVG_25M417, complete genome) position: , mismatch: 6, identity: 0.8
cccacaatttattacaagaaataataaaca CRISPR spacer
atgataatttaaaacaagaaataataaaca Protospacer
. *.****** *****************
113. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 6, identity: 0.8
cccacaatttattacaagaaataataaaca CRISPR spacer
atgataatttaaaacaagaaataataaaca Protospacer
. *.****** *****************
114. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019922 (Borreliella burgdorferi strain PAbe plasmid p_lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
115. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_015917 (Borreliella bissettii DN127 plasmid lp28-4, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
agttcttattagactataaaaataatacaa Protospacer
* * ****** ***** ***********
116. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019851 (Borreliella burgdorferi plasmid lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
117. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019761 (Borreliella burgdorferi strain B31_NRZ isolate B31 plasmid p_lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
118. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044537 (Borrelia sp. CA690 plasmid lp28-4, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatctaaataatacaa Protospacer
* * ****** ****** **********
119. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_011782 (Borreliella burgdorferi ZS7 plasmid ZS7_lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
120. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017417 (Borreliella burgdorferi N40 plasmid N40_lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
121. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_015918 (Borreliella bissettii DN127 plasmid lp28-7, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
agttcttattagactataaaaataatacaa Protospacer
* * ****** ***** ***********
122. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_004988 (Borrelia burgdorferi ATCC 35210 plasmid lp16.9, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
123. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
tgatatgattattctatcaaaataatggat Protospacer
**** ***** *************. **
124. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_001849 (Borreliella burgdorferi B31 plasmid lp17, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
aactcttattagactatcaaaataatataa Protospacer
* * ****** ***************.*
125. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_007773 (Clostridium perfringens plasmid pCPF5603, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattatactatcaaaataatacat CRISPR spacer
ttatattattataatatcaaaaagttacct Protospacer
************ ******** . *** *
126. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to MN698248 (Pelagibacter phage HTVC202P, complete genome) position: , mismatch: 6, identity: 0.8
agtattaactcctgtaattctaattaaatg-- CRISPR spacer
tgttttaactcctgtaattctaa--aagtaat Protospacer
** ******************* **.*.
127. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to AP014446 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C43-MedDCM-OCT-S31-C62, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 6, identity: 0.8
agtattaactcctgtaattctaattaaatg-- CRISPR spacer
tgttttaactcctgtaattctaa--aagtaat Protospacer
** ******************* **.*.
128. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to AP013774 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C43-MedDCM-OCT-S30-C105, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8
agtattaactcctgtaattctaattaaatg-- CRISPR spacer
tgttttaactcctgtaattctaa--aagtaat Protospacer
** ******************* **.*.
129. spacer 1.39|42160|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP023413 (Clostridium perfringens strain LLY_N11 plasmid pLLY_N11_3, complete sequence) position: , mismatch: 6, identity: 0.8
aatatcttctcttgttgtatatcattcgtc CRISPR spacer
aatatcttctcttgttttatttccataatc Protospacer
**************** *** ** * .**
130. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to MT586120 (Synechococcus phage S-CAM7 isolate 0809CC03, complete genome) position: , mismatch: 6, identity: 0.8
atattatagttagtagtttcttctttattc CRISPR spacer
atattatagttactattttcttctagcttt Protospacer
************ ** ******** **.
131. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NC_031927 (Synechococcus phage S-CAM7 isolate 0910CC49, complete genome) position: , mismatch: 6, identity: 0.8
atattatagttagtagtttcttctttattc CRISPR spacer
atattatagttactattttcttctagcttt Protospacer
************ ** ******** **.
132. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to KU686213 (Synechococcus phage S-CAM7 isolate 0910SB42, complete genome) position: , mismatch: 6, identity: 0.8
atattatagttagtagtttcttctttattc CRISPR spacer
atattatagttactattttcttctagcttt Protospacer
************ ** ******** **.
133. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007054 (Opitutaceae bacterium TAV5 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
gaatgat--aataactatatctgctttttgct CRISPR spacer
--attactaaacaactatttctgctttttgct Protospacer
** *. **.****** *************
134. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_016565 (Staphylococcus phage S24-1, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
135. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AB626962 (Staphylococcus phage S24-1 DNA, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
136. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN150710 (Staphylococcus phage vB_SauP-436A1, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
137. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_031008 (Staphylococcus phage SLPW, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
138. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_047788 (Staphylococcus phage SCH1, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
139. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_048107 (Staphylococcus phage Pabna, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
140. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY000085 (Staphylococcus phage SCH111, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
141. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AB626963 (Staphylococcus phage S13' DNA, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
142. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_031046 (Staphylococcus phage BP39, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
143. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MH107118 (Staphylococcus phage CSA13, complete genome) position: , mismatch: 6, identity: 0.8
caatgcaacactatttggaaaatgatttaa--- CRISPR spacer
aaatgcaacagtatttggaaa---atttagtgt Protospacer
********* ********** *****.
144. spacer 1.47|42688|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693397 (Marine virus AFVG_25M279, complete genome) position: , mismatch: 6, identity: 0.8
ggtaatgattcaggctctatttgatagatt CRISPR spacer
cataatgattcaggatctattagatacaat Protospacer
.************ ****** **** * *
145. spacer 1.47|42688|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693087 (Marine virus AFVG_25M280, complete genome) position: , mismatch: 6, identity: 0.8
ggtaatgattcaggctctatttgatagatt CRISPR spacer
cataatgattcaggatctattagatacaat Protospacer
.************ ****** **** * *
146. spacer 1.47|42688|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693388 (Marine virus AFVG_25M277, complete genome) position: , mismatch: 6, identity: 0.8
ggtaatgattcaggctctatttgatagatt CRISPR spacer
cataatgattcaggatctattagatacaat Protospacer
.************ ****** **** * *
147. spacer 1.47|42688|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693389 (Marine virus AFVG_25M278, complete genome) position: , mismatch: 6, identity: 0.8
ggtaatgattcaggctctatttgatagatt CRISPR spacer
cataatgattcaggatctattagatacaat Protospacer
.************ ****** **** * *
148. spacer 1.49|42820|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033050 (Virgibacillus halodenitrificans strain Bac324 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
taaaagaaagagagttatactctctttctt CRISPR spacer
ataaaaaaagagagttaaactctcttttta Protospacer
***.*********** *********.*
149. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP013810 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S33-C191, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8
gctgactgttctttgttgtttgtttcattt CRISPR spacer
gcaatatgttctttgttgtttttttcatta Protospacer
** . *************** *******
150. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP013813 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S41-C199, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 6, identity: 0.8
gctgactgttctttgttgtttgtttcattt CRISPR spacer
gcaatatgttctttgttgtttttttcatta Protospacer
** . *************** *******
151. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_018501 (Bacillus thuringiensis HD-771 plasmid p02, complete sequence) position: , mismatch: 6, identity: 0.8
gctgactgttctttgttgtttgtttcattt CRISPR spacer
tctttttgttcttcgttgtttgtttcaatt Protospacer
** .*******.************* **
152. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008811 (Campylobacter fetus subsp. venerealis 97/608 plasmid pCFV97608-1, complete sequence) position: , mismatch: 6, identity: 0.8
gctgactgt---tctttgttgtttgtttcattt CRISPR spacer
---aagtgtatctctttgttgtttctttcattt Protospacer
.* *** ************ ********
153. spacer 1.54|43150|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045273 (Bacillus megaterium strain FDU301 plasmid pFDU301A, complete sequence) position: , mismatch: 6, identity: 0.8
tcacgaagttttatgaaaagaaattgaaaa CRISPR spacer
gcataaagatttatcaaaagaaattgaaac Protospacer
**..*** ***** **************
154. spacer 1.54|43150|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044261 (Campylobacter armoricus strain CA639 plasmid pCA639-1, complete sequence) position: , mismatch: 6, identity: 0.8
tcacgaagt--tttatgaaaagaaattgaaaa CRISPR spacer
--aaaaacttatttatggaaagaaattgaaaa Protospacer
* .** * ******.**************
155. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 6, identity: 0.8
atatatt-attttaatggtaatttaatacat CRISPR spacer
-cgtgttgattttaatggtaatttaacaaat Protospacer
..*.** ******************.* **
156. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 6, identity: 0.8
atatattattttaatggtaatttaatacat CRISPR spacer
aattattattttaacggtaatttcatagac Protospacer
* ***********.******** *** *.
157. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_006870 (Bacillus mycoides pDx14.2 plasmid) position: , mismatch: 6, identity: 0.8
atatattattttaatggtaatttaatacat--- CRISPR spacer
acatattattttaatgttaatt---ttcatctg Protospacer
*.************** ***** * ***
158. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032752 (Lactobacillus plantarum subsp. argentoratensis strain DSM 16365 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
159. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054442 (Staphylococcus saprophyticus strain UTI-058y plasmid pUTI-058y-2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
160. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015860 (Lactobacillus plantarum strain LZ227 plasmid LZ227p2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
161. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028979 (Lactobacillus plantarum strain LQ80 plasmid pLQ802, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
162. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022091 (Staphylococcus saprophyticus strain FDAARGOS_355 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
163. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035171 (Lactobacillus plantarum strain SRCM103418 plasmid unnamed3) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
164. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014058 (Staphylococcus saprophyticus strain FDAARGOS_137 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
165. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014114 (Staphylococcus saprophyticus strain FDAARGOS_168 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
166. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035296 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 strain ATCC 15305 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
167. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_016643 (Staphylococcus saprophyticus subsp. saprophyticus plasmid pSSAP2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
168. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023494 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed4, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
169. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025589 (Lactobacillus plantarum strain KC3 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
170. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025589 (Lactobacillus plantarum strain KC3 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
171. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012651 (Lactobacillus plantarum strain HFC8 isolate Lactobacillus plantarum plasmid pMK03, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
172. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054435 (Staphylococcus saprophyticus strain UTI-035 plasmid pUTI-035-1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
173. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026508 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed3, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
174. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033889 (Lactobacillus plantarum strain LMT1-48 plasmid p_1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
175. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054577 (Staphylococcus saprophyticus strain UTI-050 plasmid pUTI-050-2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
176. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046665 (Lactobacillus plantarum strain 83-18 plasmid p83-18.5, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
177. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054446 (Staphylococcus saprophyticus strain UTI-056 plasmid pUTI-056-2, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
178. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028230 (Lactobacillus plantarum strain SRCM101222 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattatttattt Protospacer
. ******.**************** **
179. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_007351 (Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 = NCTC 7292 plasmid pSSP1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattgtaaatattaaattataacgta Protospacer
. ************* ******** ** *.
180. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021460 (Lactobacillus brevis strain ZLB004 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
aataaattataaataataaattatttattt Protospacer
* *****.**************** **
181. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031210 (Lactobacillus brevis strain UCCLB521 plasmid pUCCLB521_B, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
aataaattataaataataaattatttatta Protospacer
* *****.**************** **.
182. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016798 (Lactobacillus brevis strain TMW 1.2112 plasmid pl12112-1, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
aataaattataaataataaattatttattt Protospacer
* *****.**************** **
183. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050807 (Lactobacillus plantarum strain SPC-SNU 72-2 plasmid pLBP511, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
aataaattataaataataaattatttatta Protospacer
* *****.**************** **.
184. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT074137 (Bacteroides phage DAC16, complete genome) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattatt---acttg CRISPR spacer
aacaaattgtaaataataaaatatttagac--- Protospacer
* ***************** **** **
185. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT074142 (Bacteroides phage DAC23, complete genome) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattatt---acttg CRISPR spacer
aacaaattgtaaataataaaatatttagac--- Protospacer
* ***************** **** **
186. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT074146 (Bacteroides phage SJC03, complete genome) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattatt---acttg CRISPR spacer
aacaaattgtaaataataaaatatttagac--- Protospacer
* ***************** **** **
187. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_013379 (Staphylococcus epidermidis plasmid SAP106A, complete sequence) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataataaattattacttg CRISPR spacer
aaaaaattataaataataaagtattccagg Protospacer
* ******.*********** **** * *
188. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017918 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ4 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 6, identity: 0.8
acaaaattgtaaataat-aaattattacttg CRISPR spacer
taaaaattgtaaataataaaataaatattt- Protospacer
*************** **** * **.**
189. spacer 1.62|43678|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044538 (Borrelia sp. CA690 plasmid lp28-2, complete sequence) position: , mismatch: 6, identity: 0.8
tctaaacttatcagcaaaccacatttatca CRISPR spacer
tctaaatttatcagcaatccacaggaagca Protospacer
******.********** ***** * **
190. spacer 1.66|39852|30|NC_006908|PILER-CR matches to MT457553 (Shewanella phage Thanatos-2, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
191. spacer 1.66|39852|30|NC_006908|PILER-CR matches to MT457552 (Shewanella phage Thanatos-1, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
192. spacer 1.67|39918|30|NC_006908|PILER-CR matches to KF114877 (Leptospira phage LnoZ_CZ214, complete genome) position: , mismatch: 6, identity: 0.8
tgaatctcttcttcgtttaatgtatcacgt CRISPR spacer
tgaaactcttcttcgtttaatgtaacgata Protospacer
**** ******************* *.
193. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897276 (Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
194. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897280 (Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
195. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897275 (Clostridium botulinum strain IFR 12/29 plasmid p12/29, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
196. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897277 (Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
197. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897278 (Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
198. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_KT897279 (Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagttttaaaatttgatattaattttaatc Protospacer
******.*** ***************
199. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP019367 (Borrelia turicatae 91E135 isolate Oz1 plasmid lpG29, complete sequence) position: , mismatch: 6, identity: 0.8
atgttttagaatatgatattaattttaaaa CRISPR spacer
atcttttagaatctgatattaatttctcat Protospacer
** ********* ************. *
200. spacer 1.71|40182|30|NC_006908|PILER-CR matches to MT457553 (Shewanella phage Thanatos-2, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
201. spacer 1.71|40182|30|NC_006908|PILER-CR matches to MT457552 (Shewanella phage Thanatos-1, complete genome) position: , mismatch: 6, identity: 0.8
atataaaaaattttatttccgaaagtgaat CRISPR spacer
aaacagaaaattttatttctgaaattgaaa Protospacer
* *.*.*************.**** ****
202. spacer 1.72|40248|30|NC_006908|PILER-CR matches to NZ_CP009636 (Bacillus cereus 03BB108 plasmid pBFI_2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaggttatacagttgctttaaatactta CRISPR spacer
agtaggttatacagttgttttaaataggat Protospacer
****************.********
203. spacer 1.72|40248|30|NC_006908|PILER-CR matches to NZ_CP053962 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tgtaggttatacagttgctttaaatactta CRISPR spacer
agtaggttatacagttgttttaaataggat Protospacer
****************.********
204. spacer 1.73|40314|30|NC_006908|PILER-CR matches to NZ_CP020096 (Lactobacillus plantarum strain K25 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
205. spacer 1.73|40314|30|NC_006908|PILER-CR matches to NZ_CP028245 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
206. spacer 1.73|40314|30|NC_006908|PILER-CR matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
207. spacer 1.73|40314|30|NC_006908|PILER-CR matches to NZ_CP035152 (Pediococcus acidilactici strain SRCM103367 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
caatgc--agcactatttagaaaatgatttaa CRISPR spacer
--attctaagaaatatttagaaaatgatttag Protospacer
** * ** * ******************.
208. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP035398 (Bacillus subtilis strain SRCM103773 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.***.. ************* ********
209. spacer 1.74|40380|30|NC_006908|PILER-CR matches to NZ_CP010015 (Bacillus sp. YP1 plasmid pBUYP1, complete sequence) position: , mismatch: 6, identity: 0.8
cagaccag--ccttattataaaagtgaaattt CRISPR spacer
--aaccgactccttattataaaattgaaattt Protospacer
.***.. ************* ********
210. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
tttaattttgcgctatctttaattttttta CRISPR spacer
ttttcaattgcgctttctttaatttttgta Protospacer
*** ******* ************ **
211. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 6, identity: 0.8
tttaattttgcgctatctttaattttttta CRISPR spacer
ttttcaattgcgctttctttaatttttgta Protospacer
*** ******* ************ **
212. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_CP040803 (Streptococcus salivarius strain LAB813 plasmid pSAL813, complete sequence) position: , mismatch: 6, identity: 0.8
---tttaattttgcgctatctttaattttttta CRISPR spacer
gagtt---ttttgcgctatttttaatgtttttt Protospacer
** ***********.****** *****
213. spacer 1.75|40446|30|NC_006908|PILER-CR matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 6, identity: 0.8
tttaa---ttttgcgctatctttaattttttta CRISPR spacer
---aagtcttttgcgttatctttaatttcttga Protospacer
** *******.************.** *
214. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KX686749 (Campylobacter coli strain Tx40 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
215. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
216. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007182 (Campylobacter coli RM4661 plasmid pRM4661_48kbp, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
217. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_006134 (Campylobacter coli plasmid pCC31, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
218. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
219. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007180 (Campylobacter coli RM5611 plasmid pRM5611_48kb, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
220. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017869 (Campylobacter coli strain MG1116 plasmid pCCDM116L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
221. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
222. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
223. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP010073 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
224. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
225. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
226. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
227. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
228. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
229. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017418 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
230. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017419 (Campylobacter jejuni strain MTVDSCj16 plasmid pMTVDSCj16-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
231. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017866 (Campylobacter coli strain YF2105 plasmid pCCDM105L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
232. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017879 (Campylobacter coli strain BG2108 plasmid pCCDM108L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
233. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
234. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
235. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP020775 (Campylobacter jejuni strain YH002 plasmid pCJP002, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
236. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
237. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KJ646012 (Campylobacter jejuni strain 11601MD plasmid p11601MD, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
238. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
239. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017282 (Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
240. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013035 (Campylobacter coli strain HC2-48 plasmid pccdm1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
241. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007752 (Campylobacter jejuni subsp. jejuni D42a plasmid pTet-D42a, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
242. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
243. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
244. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
245. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP011017 (Campylobacter coli strain FB1 plasmid pFB1TET, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
246. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017030 (Campylobacter jejuni subsp. jejuni strain 14980A plasmid pCJ14980A, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
247. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
248. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017877 (Campylobacter coli strain ZV1224 plasmid pCCDM224L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
249. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044168 (Campylobacter jejuni strain AR-0415 plasmid pAR-0415, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
250. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP040609 (Campylobacter sp. CFSAN093226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
251. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017861 (Campylobacter jejuni strain TS1218 plasmid pCJDM218, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
252. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP043764 (Campylobacter jejuni strain BfR-CA-14430 plasmid pBfR-CA-14430, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
253. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007750 (Campylobacter jejuni subsp. jejuni M129 plasmid pTet-M129, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
254. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP048762 (Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
255. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_MK541988 (Campylobacter coli strain CVM N61740F plasmid pN61740F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
256. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_MK541989 (Campylobacter coli strain CVM N61925F plasmid pN61925F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
257. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
258. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KX686749 (Campylobacter coli strain Tx40 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
259. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
260. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007182 (Campylobacter coli RM4661 plasmid pRM4661_48kbp, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
261. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_006134 (Campylobacter coli plasmid pCC31, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
262. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
263. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007180 (Campylobacter coli RM5611 plasmid pRM5611_48kb, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
264. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017869 (Campylobacter coli strain MG1116 plasmid pCCDM116L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
265. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
266. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
267. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP010073 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
268. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
269. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
270. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
271. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
272. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
273. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017418 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
274. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017419 (Campylobacter jejuni strain MTVDSCj16 plasmid pMTVDSCj16-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
275. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017866 (Campylobacter coli strain YF2105 plasmid pCCDM105L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
276. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017879 (Campylobacter coli strain BG2108 plasmid pCCDM108L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
277. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
278. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
279. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP020775 (Campylobacter jejuni strain YH002 plasmid pCJP002, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
280. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
281. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KJ646012 (Campylobacter jejuni strain 11601MD plasmid p11601MD, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
282. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
283. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017282 (Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
284. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013035 (Campylobacter coli strain HC2-48 plasmid pccdm1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
285. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007752 (Campylobacter jejuni subsp. jejuni D42a plasmid pTet-D42a, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
286. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
287. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
288. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
289. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP011017 (Campylobacter coli strain FB1 plasmid pFB1TET, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
290. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017030 (Campylobacter jejuni subsp. jejuni strain 14980A plasmid pCJ14980A, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
291. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
292. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017877 (Campylobacter coli strain ZV1224 plasmid pCCDM224L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
293. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044168 (Campylobacter jejuni strain AR-0415 plasmid pAR-0415, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
294. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP040609 (Campylobacter sp. CFSAN093226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
295. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017861 (Campylobacter jejuni strain TS1218 plasmid pCJDM218, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
296. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP043764 (Campylobacter jejuni strain BfR-CA-14430 plasmid pBfR-CA-14430, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
297. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP007750 (Campylobacter jejuni subsp. jejuni M129 plasmid pTet-M129, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
298. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP048762 (Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
299. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_MK541988 (Campylobacter coli strain CVM N61740F plasmid pN61740F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
300. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_MK541989 (Campylobacter coli strain CVM N61925F plasmid pN61925F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
301. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
302. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
ggactttagaatatgatagtatttttaaag Protospacer
. ..************** ** *******.
303. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP015334 (Borrelia hermsii HS1 isolate Browne Mountain plasmid lpG27, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
actttttagaatctgatattaatttatcat Protospacer
*. ********* ************ *
304. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NC_019772 (Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aagttttagaaaatgatattaatagtgtag Protospacer
* ********* *********** *. *.
305. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
306. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP043831 (Bacillus sp. BS98 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
307. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
308. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
309. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
310. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
311. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
312. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
313. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
314. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019065 (Rahnella sp. ERMR1:05 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
catgaagtgtagaaaaaaaattatttctgg Protospacer
.** ********* **********.*.*..
315. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
316. spacer 1.10|40247|30|NC_006908|CRISPRCasFinder,CRT matches to NC_013862 (Allochromatium vinosum DSM 180 plasmid pALVIN02, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaggttatacagttgctttaaatactta CRISPR spacer
gccagtttatacagttgctttgaatactcg Protospacer
.** ***************.******..
317. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to MH617467 (Inoviridae sp. isolate ctba17, complete genome) position: , mismatch: 7, identity: 0.767
caatgcagcactatttagaaaatgatttaa--- CRISPR spacer
caatgccgaactatttagaaa---atctagacc Protospacer
****** * ************ **.**.
318. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 7, identity: 0.767
tttaattttgcgctatctttaattttttta CRISPR spacer
actaattttgcgccatccttaattttatgg Protospacer
.***********.***.******** * .
319. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP018188 (Streptococcus salivarius strain ICDC2 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
tttaattttgcgctatctttaattttttta CRISPR spacer
agtttttttgcgctatttttaatgtttttt Protospacer
* ***********.****** *****
320. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
tagtagagaattagatttattactaaatga Protospacer
*. ..***** ****** ***********
321. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to CP016970 (Staphylococcus epidermidis strain DAR1907 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
cataaaagaaggagattttttactaagaaa Protospacer
* *.***** ***************. .*
322. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
tacagaagaattagatattttactaatata Protospacer
* ******** **** ********* *
323. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP024445 (Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
gactgaagaaagagattttttactatctca Protospacer
.* ****** ************** * *
324. spacer 1.14|40511|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP018283 (Chondrocystis sp. NIES-4102 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
aaaagaagaataagatttttttgtataact Protospacer
***********.********* ** *
325. spacer 1.16|40643|29|NC_006908|CRISPRCasFinder,CRT matches to NZ_AP019847 (Leptotrichia hongkongensis strain JMUB5056 plasmid pJMUB5056, complete sequence) position: , mismatch: 7, identity: 0.759
ctgcaggacaaataactttaagaaataca CRISPR spacer
ttcagcgataaacaactttaagaaataca Protospacer
.* . **.***.****************
326. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP024218 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-10) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
tataagaataatagaaaataatcaatcatt Protospacer
* ****** ****************
327. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP024405 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp18-1, complete sequence) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
tataagaataatagaaaataatcaatcatt Protospacer
* ****** ****************
328. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP024364 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-9) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
tataagaataatagaaaataatcaatcatt Protospacer
* ****** ****************
329. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP024384 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
tataagaataatagaaaataatcaatcatt Protospacer
* ****** ****************
330. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017576 (Bacillus thuringiensis strain SCG04-02 plasmid PSCG5, complete sequence) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
ttattctaacataaaaaataatcaatataa Protospacer
** ******.**************.*
331. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP019233 (Bacillus thuringiensis strain YGd22-03 plasmid pYGD5, complete sequence) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
ttattctaacataaaaaataatcaatataa Protospacer
** ******.**************.*
332. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017263 (Lactobacillus paracasei strain FAM18149 plasmid pFAM18149.22, complete sequence) position: , mismatch: 7, identity: 0.767
tttaagaaacatagaaaataatcaatatga CRISPR spacer
tttaaaaaacatagaaaataactctcctga Protospacer
*****.***************.. . ***
333. spacer 1.19|40840|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023400 (Pseudoalteromonas spongiae strain SAO4-4 plasmid pl, complete sequence) position: , mismatch: 7, identity: 0.767
tgacgaaactcattcatatcaatacctttt CRISPR spacer
aaattaatttcattgatatcaatacctttt Protospacer
.*. ** .***** ***************
334. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028569 (Acinetobacter pittii strain WCHAP005046 plasmid p1_005046, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
335. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023025 (Acinetobacter baumannii strain 10324 plasmid pAba10324c, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
336. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041590 (Acinetobacter baumannii strain J9 plasmid pJ9-3, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
337. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018333 (Acinetobacter baumannii strain A1296 isolate A1296 plasmid pA1296_1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
338. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028139 (Acinetobacter baumannii strain NCIMB 8209 plasmid pAbNCIMB8209_134, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
339. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027185 (Acinetobacter baumannii strain AR_0052 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
340. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP033551 (Acinetobacter nosocomialis strain 2014S01-097 plasmid p2014S01-097-1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
341. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP033546 (Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
342. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034093 (Acinetobacter baumannii strain A52 plasmid pA52-1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
343. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026128 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-1fe1, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
344. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_023031 (Acinetobacter baumannii ZW85-1 plasmid ZW85p2, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
345. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027182 (Acinetobacter baumannii strain AR_0070 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
cttcaaaacaaatcttaatttgaatttaaa Protospacer
. . ********** ****** *******
346. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN694663 (Marine virus AFVG_250M439, complete genome) position: , mismatch: 7, identity: 0.767
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
tgattaaataaatctaaatttgtatctgta Protospacer
******.*************.**.*. *
347. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MN856078 (Bacteriophage sp. isolate 83, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
tatttgcatgatagaattttgctaattcta Protospacer
. *. *******. ***************
348. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
tatcatcatgataatattttgcaaacagta Protospacer
. ***.**************** **. **
349. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MK448392 (Streptococcus satellite phage Javan27, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
ctgatacattaaaatattttgctaattctt Protospacer
** *** * *****************
350. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MK448336 (Streptococcus satellite phage Javan15, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
ctgatacattaaaatattttgctaattctt Protospacer
** *** * *****************
351. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MK448660 (Streptococcus satellite phage Javan9, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
ctgatacattaaaatattttgctaattctt Protospacer
** *** * *****************
352. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MK448370 (Streptococcus satellite phage Javan22, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
ctgatacattaaaatattttgctaattctt Protospacer
** *** * *****************
353. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MK448955 (Streptococcus phage Javan478, complete genome) position: , mismatch: 7, identity: 0.767
cttcaccatgataatattttgctaattcta CRISPR spacer
ctgatacattaaaatattttgctaattctt Protospacer
** *** * *****************
354. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to MK448707 (Streptococcus phage Javan227, complete genome) position: , mismatch: 7, identity: 0.767
tcattgtataatctttttttcaatttgtat CRISPR spacer
aatttctataacctttttttcaatttgttc Protospacer
** *****.**************** .
355. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to MT939488 (Erwinia phage pEa_SNUABM_50, complete genome) position: , mismatch: 7, identity: 0.767
tcattgtataatctttttttcaatttgtat CRISPR spacer
ggattgtttcatctttttttcaatttttgc Protospacer
***** * **************** *..
356. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028869 (Borreliella garinii strain 20047 plasmid lp28-7, complete sequence) position: , mismatch: 7, identity: 0.767
cagatcaaccttattataaaagtgaaattt CRISPR spacer
aaccttcactttattataaaagtgaacttt Protospacer
* *. **.**************** ***
357. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028878 (Borreliella bavariensis PBi plasmid lp28-7, complete sequence) position: , mismatch: 7, identity: 0.767
cagatcaaccttattataaaagtgaaattt CRISPR spacer
aaccttcactttattataaaagtgaacttt Protospacer
* *. **.**************** ***
358. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP018749 (Borreliella garinii strain CIP 103362 isolate 20047 plasmid lp28-7) position: , mismatch: 7, identity: 0.767
cagatcaaccttattataaaagtgaaattt CRISPR spacer
aaccttcactttattataaaagtgaacttt Protospacer
* *. **.**************** ***
359. spacer 1.30|41566|30|NC_006908|CRISPRCasFinder,CRT matches to NC_017235 (Borreliella afzelii PKo plasmid lp28-7, complete sequence) position: , mismatch: 7, identity: 0.767
cagatcaaccttattataaaagtgaaattt CRISPR spacer
aaccttcactttattataaaagtgaacttt Protospacer
* *. **.**************** ***
360. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cccacaatttattacaagaaataataaaca CRISPR spacer
aaattaatttattagaagaaataataaata Protospacer
.********* *************.*
361. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 7, identity: 0.767
cccacaatttattacaagaaataataaaca CRISPR spacer
attacaatttattaccagaaataatagtaa Protospacer
..************ **********. *
362. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cccacaatttattacaagaaataataaaca CRISPR spacer
attacaatttattaccagaaataatagtaa Protospacer
..************ **********. *
363. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 7, identity: 0.767
cccacaatttattacaagaaataataaaca CRISPR spacer
cgagaaatttattataagaaataaaaaaaa Protospacer
* . *********.********* *** *
364. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP011016 (Campylobacter coli strain FB1 plasmid pCC42, complete sequence) position: , mismatch: 7, identity: 0.767
atatattattatactatcaaaataatacat CRISPR spacer
taatattattatgatatcaaaataatatca Protospacer
**********. *************.
365. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 7, identity: 0.767
atatattattatactatcaaaataatacat CRISPR spacer
ttttattattttacaatcaaaataataaga Protospacer
* ******* *** ************ .
366. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NC_015270 (Enterococcus phage EFRM31, complete genome) position: , mismatch: 7, identity: 0.767
atatattattatactatcaaaataatacat CRISPR spacer
cgctattattatactatacaaataatatag Protospacer
************** ********.*
367. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to MK982307 (Enterococcus phage MSF2, complete genome) position: , mismatch: 7, identity: 0.767
atatattattatactatcaaaataatacat CRISPR spacer
cgctattattatactatacaaataatatag Protospacer
************** ********.*
368. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to KC153026 (Leuconostoc phage 2 HN-2013 putative major tail protein and putative tail measure protein genes, complete cds) position: , mismatch: 7, identity: 0.767
agtattaactcctgtaattctaattaaatg CRISPR spacer
ggtattaactcctgtaattcaatttgttgg Protospacer
.******************* * **. *
369. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to NC_024380 (Leuconostoc phage phiLN6B, complete genome) position: , mismatch: 7, identity: 0.767
agtattaactcctgtaattctaattaaatg CRISPR spacer
ggtattaactcctgtaattcaatttgttgg Protospacer
.******************* * **. *
370. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to HQ634175 (Cyanophage P-RSM1 genomic sequence) position: , mismatch: 7, identity: 0.767
agtattaactcctgtaattctaattaaatg CRISPR spacer
agtatcaactcctgcaattctaactctttc Protospacer
*****.********.********.* *
371. spacer 1.39|42160|30|NC_006908|CRISPRCasFinder,CRT matches to NC_019688 (Clostridium perfringens plasmid pNetB-NE10, complete sequence) position: , mismatch: 7, identity: 0.767
aatatcttctcttgttgtatatcattcgtc CRISPR spacer
aatatcttctcttgttttatttccataatt Protospacer
**************** *** ** * .*.
372. spacer 1.39|42160|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP025502 (Clostridium perfringens strain EHE-NE18 plasmid pJIR3535, complete sequence) position: , mismatch: 7, identity: 0.767
aatatcttctcttgttgtatatcattcgtc CRISPR spacer
aatatcttctcttgttttatttccataatt Protospacer
**************** *** ** * .*.
373. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897276 (Clostridium botulinum strain INGR16-02E1 plasmid pINGR16-02E1, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
374. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897280 (Clostridium botulinum strain FI1111E1 plasmid pFI1111E1, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
375. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897275 (Clostridium botulinum strain IFR 12/29 plasmid p12/29, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
376. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897277 (Clostridium botulinum strain ST0210E1 plasmid pST0210E1, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
377. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897278 (Clostridium botulinum strain FWSKR40E1 plasmid pFWSKR40E1, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
378. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_KT897279 (Clostridium botulinum strain SWKR38E2 plasmid pSWKR38E2, complete sequence) position: , mismatch: 7, identity: 0.767
atattatagttagtagtttcttctttattc CRISPR spacer
ctattatagctagtagtatcttctccataa Protospacer
********.******* ******..**
379. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048111 (Klebsiella michiganensis strain BD177 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
gaatgataataactatatctgctttttgct CRISPR spacer
caaatataattactatatctgctttttttg Protospacer
** ***** **************** .
380. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MG945690 (UNVERIFIED: Microviridae sp. isolate 1419-1711, complete genome) position: , mismatch: 7, identity: 0.767
tactggatttgaattaaattttgatgacgg CRISPR spacer
gattggattttaattaaattttgatttttg Protospacer
*.******* ************** . *
381. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KC292023 (Halovirus HRTV-4, complete genome) position: , mismatch: 7, identity: 0.767
tactggatttgaattaaattttgatgacgg CRISPR spacer
agatggatttgaattagaatttgatgattg Protospacer
. *************.* ********. *
382. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to LR721753 (Aliivibrio wodanis 06/09/160 plasmid 2 complete sequence) position: , mismatch: 7, identity: 0.767
tactggatttgaattaaattttgatgacgg CRISPR spacer
ttatttatttgaattaaactttaatgacgt Protospacer
* * ************.***.******
383. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AF513032 (Staphylococcus phage phi44AHJD, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacaatatttggaaaatttagtat Protospacer
********* ************ **
384. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_004678 (Staphylococcus phage 44AHJD, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacaatatttggaaaatttagtat Protospacer
********* ************ **
385. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_004679 (Staphylococcus phage phiP68, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacaatatttggaaaatttagtat Protospacer
********* ************ **
386. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AF513033 (Staphylococcus aureus phage phiP68, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacaatatttggaaaatttagtat Protospacer
********* ************ **
387. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MG766219 (Staphylococcus phage vB_SauP_phiAGO1.9, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttagtat Protospacer
********* ************ **
388. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN098325 (Staphylococcus phage Portland, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttggtat Protospacer
********* ************ **
389. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MG766218 (Staphylococcus phage vB_SauP_phiAGO1.3, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttagtat Protospacer
********* ************ **
390. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AY954949 (Bacteriophage 66, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttagtat Protospacer
********* ************ **
391. spacer 1.46|42622|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_007046 (Staphylococcus phage 66, complete genome) position: , mismatch: 7, identity: 0.767
caatgcaacactatttggaaaatgatttaa CRISPR spacer
aaatgcaacagtatttggaaaatttagtat Protospacer
********* ************ **
392. spacer 1.48|42754|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MH412654 (Synechococcus phage S-T4, complete genome) position: , mismatch: 7, identity: 0.767
agactcaagcaccaatagattcagtattaa CRISPR spacer
aaactctagaaccaatagattcagtgtctc Protospacer
*.**** ** ***************.*.
393. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP013561 (Uncultured Mediterranean phage uvMED isolate uvMED-CGR-C15D-MedDCM-OCT-S44-C14, *** SEQUENCING IN PROGRESS ***, 10 ordered pieces) position: , mismatch: 7, identity: 0.767
gctgactgttctttgttgtttgtttcattt CRISPR spacer
gcaatatgttctttattgtttttttcatta Protospacer
** . ********.****** *******
394. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP014452 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S29-C199, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 7, identity: 0.767
gctgactgttctttgttgtttgtttcattt CRISPR spacer
gcaatatgttctttattgtttttttcatta Protospacer
** . ********.****** *******
395. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP013843 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15D-MedDCM-OCT-S42-C21, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
gctgactgttctttgttgtttgtttcattt CRISPR spacer
gcaatatgttctttattgtttttttcatta Protospacer
** . ********.****** *******
396. spacer 1.51|42952|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
attctgcccaactaataaatcaaaaaaata CRISPR spacer
ataaagcccaactaataaattacaaaaaat Protospacer
** ***************.* *****
397. spacer 1.51|42952|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
attctgcccaactaataaatcaaaaaaata CRISPR spacer
ataaagcccaactaataaattacaaaaaat Protospacer
** ***************.* *****
398. spacer 1.52|43018|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 7, identity: 0.767
tgtctgtatctaaataataaacattttttc CRISPR spacer
cttcaaaatctaaataataaccatttgttc Protospacer
. ** . ************* ***** ***
399. spacer 1.52|43018|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN694392 (Marine virus AFVG_250M8, complete genome) position: , mismatch: 7, identity: 0.767
tgtctgtatctaaataataaacattttttc CRISPR spacer
cttcaaaatctaaataataaccatttgttc Protospacer
. ** . ************* ***** ***
400. spacer 1.53|43084|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MF063068 (Pseudomonas phage Noxifer, complete genome) position: , mismatch: 7, identity: 0.767
gcactgtctgcaagctttgcttatgtagct CRISPR spacer
gcagcgtctgcaagctttgcttaaagacat Protospacer
*** .****************** . * *
401. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214939 (Mycoplasma salivarium strain NCTC10113 plasmid 2) position: , mismatch: 7, identity: 0.767
ctaatttatcaaatgaaattgttaatttat CRISPR spacer
cggaaacatcaaatgattttgttaatttat Protospacer
* .* .********* ************
402. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018322 (Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence) position: , mismatch: 7, identity: 0.767
ctaatttatcaaatgaaattgttaatttat CRISPR spacer
ataatttagcaaatgaaatggttaatgcta Protospacer
******* ********** ****** .
403. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to AP014323 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S33-C38, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767
ctaatttatcaaatgaaattgttaatttat CRISPR spacer
ataatttattaaattaaattgttaaaaatt Protospacer
********.**** ********** *
404. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979239 (Flavobacterium phage V156, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
405. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585306 (Flavobacterium phage FCOV-F43, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
406. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585275 (Flavobacterium phage FCOV-F4, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
407. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585280 (Flavobacterium phage FCOV-F12, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
408. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756088 (Flavobacterium phage FCOV-F25, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
409. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY951963 (Flavobacterium phage FCV-3, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
410. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585285 (Flavobacterium phage FCOV-F19, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
411. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756089 (Flavobacterium phage FCOV-F27, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
412. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585297 (Flavobacterium phage FCOV-F33, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
413. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585274 (Flavobacterium phage FCOV-F3, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
414. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585315 (Flavobacterium phage V189, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
415. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585277 (Flavobacterium phage FCOV-F8, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
416. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585300 (Flavobacterium phage FCOV-F36, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
417. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979242 (Flavobacterium phage V182, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
418. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756084 (Flavobacterium phage FCOV-F6, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
419. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979243 (Flavobacterium phage VK20, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
420. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585273 (Flavobacterium phage FCOV-F1, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
421. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585298 (Flavobacterium phage FCOV-F34, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
422. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585286 (Flavobacterium phage FCOV-F20, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
423. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585296 (Flavobacterium phage FCOV-F32, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
424. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979246 (Flavobacterium phage VK52, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
425. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585314 (Flavobacterium phage V188, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
426. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585287 (Flavobacterium phage FCOV-F21, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
427. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY992519 (Flavobacterium phage V175, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
428. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756091 (Flavobacterium phage FCOV-F45, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
429. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585299 (Flavobacterium phage FCOV-F35, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
430. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585279 (Flavobacterium phage FCOV-F11, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
431. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585295 (Flavobacterium phage FCOV-F31, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
432. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585304 (Flavobacterium phage FCOV-F41, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
433. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585288 (Flavobacterium phage FCOV-F22, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
434. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585309 (Flavobacterium phage FCOV-F48, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
435. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585293 (Flavobacterium phage FCOV-F29, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
436. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585291 (Flavobacterium phage FCOV-F26, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
437. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585302 (Flavobacterium phage FCOV-F39, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
438. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585284 (Flavobacterium phage FCOV-F18, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
439. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756087 (Flavobacterium phage FCOV-F16, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
440. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585305 (Flavobacterium phage FCOV-F42, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
441. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585290 (Flavobacterium phage FCOV-F24, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
442. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KM873719 (Flavobacterium phage FCL-2, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
443. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585311 (Flavobacterium phage V183, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
444. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585278 (Flavobacterium phage FCOV-F10, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
445. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585294 (Flavobacterium phage FCOV-F30, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
446. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY951964 (Flavobacterium phage FCV-11, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
447. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585283 (Flavobacterium phage FCOV-F17, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
448. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585301 (Flavobacterium phage FCOV-F38, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
449. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979236 (Flavobacterium phage FCV-10, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
450. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979237 (Flavobacterium phage FCV-16, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
451. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979240 (Flavobacterium phage V157, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
452. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585303 (Flavobacterium phage FCOV-F40, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
453. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979241 (Flavobacterium phage V165, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
454. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585282 (Flavobacterium phage FCOV-F15, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
455. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979238 (Flavoibacterium phage FCV-20, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
456. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979247 (Flavobacterium phage VK58, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
457. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756083 (Flavobacterium phage FCOV-F2, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
458. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756085 (Flavobacterium phage FCOV-F9, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
459. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756086 (Flavobacterium phage FCOV-F13, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
460. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY992520 (Flavobacterium phage V181, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
461. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756093 (Flavobacterium phage FCOV-F54, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
462. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585308 (Flavobacterium phage FCOV-F47, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
463. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT431535 (Flavobacterium phage FCV-1.01, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
464. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756092 (Flavobacterium phage FCOV-F46, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
465. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756096 (Flavobacterium phage V186, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
466. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979244 (Flavobacterium phage VK42, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
467. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585310 (Flavobacterium phage FCOV-F56, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
468. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585292 (Flavobacterium phage FCOV-F28, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
469. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_041845 (Flavobacterium phage FCV-1, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
470. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585281 (Flavobacterium phage FCOV-F14, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
471. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585276 (Flavobacterium phage FCOV-F7, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
472. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585289 (Flavobacterium phage FCOV-F23, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
473. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756094 (Flavobacterium phage FCOV-S1, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
474. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756090 (Flavobacterium phage FCOV-F37, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
475. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585312 (Flavobacterium phage V184, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
476. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT585307 (Flavobacterium phage FCOV-F44, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
477. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY979245 (Flavobacterium phage VK48, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
478. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK756095 (Flavobacterium phage FCOV-S2, complete genome) position: , mismatch: 7, identity: 0.767
--ctaatttatcaaatgaaattgttaatttat CRISPR spacer
actcaa--tattaaatgaaactgttaatttag Protospacer
..** ***.********.**********
479. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MG264739 (UNVERIFIED: Enterococcus phage phiNASRA1, complete genome) position: , mismatch: 7, identity: 0.767
tgattatataagagagcaccaaaatgctta- CRISPR spacer
caattatataagagagaacc-aaataccaat Protospacer
..************** *** ****.*. *
480. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gtatattattataatgataatttaaaatca Protospacer
.********* *****.******** *.
481. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gcatctgcatttaatggtaatttaatagat Protospacer
..** * ****************** **
482. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gtatattattataatgataatttaaaatca Protospacer
.********* *****.******** *.
483. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250016 (Prevotella phage Lak-A1, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gcatctgcatttaatggtaatttaatagat Protospacer
..** * ****************** **
484. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gtatattattataatgataatttaaaatca Protospacer
.********* *****.******** *.
485. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 7, identity: 0.767
atatattattttaatggtaatttaatacat CRISPR spacer
gcatctgcatttaatggtaatttaatagat Protospacer
..** * ****************** **
486. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037430 (Lactobacillus plantarum strain EM plasmid pEM1, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
487. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037430 (Lactobacillus plantarum strain EM plasmid pEM1, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
488. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_021225 (Lactobacillus plantarum subsp. plantarum P-8 plasmid LBPp2, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
489. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaatttttaataataaattattggttt Protospacer
****** * **************. **
490. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaattgtaaaaaataaaatatttcata Protospacer
*********** ****** **** * *.
491. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035027 (Lactobacillus plantarum strain YW11 plasmid plsm_YW11_pB, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
492. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035027 (Lactobacillus plantarum strain YW11 plasmid plsm_YW11_pB, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
493. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035013 (Lactobacillus plantarum strain 12_3 plasmid pldA, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
494. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035022 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pB) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
495. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035022 (Lactobacillus plantarum strain 13_3 plasmid plsm_LP12_3_pB) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
496. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017407 (Lactobacillus plantarum strain RI-113 plasmid pRI113_1, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
497. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_022782 (Bacillus toyonensis BCT-7112 plasmid pBCT77, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
ccataattgtaaataaaaaattatggctat Protospacer
** ************ ******* .**
498. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028225 (Lactobacillus plantarum strain SRCM101105 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaattataaataataaattacttattt Protospacer
. ******.**************.* **
499. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to HQ331142 (Salmonella phage S16, complete genome) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
acaaaattgtaaagattaaattacagggtg Protospacer
************* * *******. . **
500. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to JX181825 (Salmonella phage STML-198, complete genome) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
acaaaattgtaaagattaaattacagggtg Protospacer
************* * *******. . **
501. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KJ000058 (Salmonella phage STP4-a, complete genome) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
acaaaattgtaaagattaaattacagggtg Protospacer
************* * *******. . **
502. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_042044 (Salmonella phage Melville, complete genome) position: , mismatch: 7, identity: 0.767
acaaaattgtaaataataaattattacttg CRISPR spacer
acaaaattgtaaagattaaattacagggtg Protospacer
************* * *******. . **
503. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_KX686749 (Campylobacter coli strain Tx40 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
504. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
505. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP007182 (Campylobacter coli RM4661 plasmid pRM4661_48kbp, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
506. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_006134 (Campylobacter coli plasmid pCC31, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
507. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
508. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP007180 (Campylobacter coli RM5611 plasmid pRM5611_48kb, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
509. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017869 (Campylobacter coli strain MG1116 plasmid pCCDM116L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
510. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
511. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
512. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP010073 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
513. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
514. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
515. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
516. spacer 1.64|39720|30|NC_006908|PILER-CR matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
517. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
518. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017418 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
519. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017419 (Campylobacter jejuni strain MTVDSCj16 plasmid pMTVDSCj16-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
520. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017866 (Campylobacter coli strain YF2105 plasmid pCCDM105L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
521. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017879 (Campylobacter coli strain BG2108 plasmid pCCDM108L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
522. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
523. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
524. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP020775 (Campylobacter jejuni strain YH002 plasmid pCJP002, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
525. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
526. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_KJ646012 (Campylobacter jejuni strain 11601MD plasmid p11601MD, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
527. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
528. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_017282 (Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
529. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP013035 (Campylobacter coli strain HC2-48 plasmid pccdm1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
530. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP007752 (Campylobacter jejuni subsp. jejuni D42a plasmid pTet-D42a, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
531. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
532. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
533. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
534. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP011017 (Campylobacter coli strain FB1 plasmid pFB1TET, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
535. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017030 (Campylobacter jejuni subsp. jejuni strain 14980A plasmid pCJ14980A, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
536. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
537. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017877 (Campylobacter coli strain ZV1224 plasmid pCCDM224L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
538. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP044168 (Campylobacter jejuni strain AR-0415 plasmid pAR-0415, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
539. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP040609 (Campylobacter sp. CFSAN093226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
540. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP017861 (Campylobacter jejuni strain TS1218 plasmid pCJDM218, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
541. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP043764 (Campylobacter jejuni strain BfR-CA-14430 plasmid pBfR-CA-14430, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
542. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP007750 (Campylobacter jejuni subsp. jejuni M129 plasmid pTet-M129, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
543. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_CP048762 (Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
544. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_MK541988 (Campylobacter coli strain CVM N61740F plasmid pN61740F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
545. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_MK541989 (Campylobacter coli strain CVM N61925F plasmid pN61925F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
546. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
547. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_KX686749 (Campylobacter coli strain Tx40 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
548. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
549. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP007182 (Campylobacter coli RM4661 plasmid pRM4661_48kbp, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
550. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_006134 (Campylobacter coli plasmid pCC31, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
551. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_006135 (Campylobacter jejuni subsp. jejuni 81-176 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
552. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP007180 (Campylobacter coli RM5611 plasmid pRM5611_48kb, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
553. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017869 (Campylobacter coli strain MG1116 plasmid pCCDM116L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
554. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
555. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP045046 (Campylobacter jejuni subsp. jejuni strain NADC 20827 plasmid p20827L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
556. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP010073 (Campylobacter jejuni subsp. jejuni strain 01-1512 plasmid pCj1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
557. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017857 (Campylobacter jejuni strain YQ2210 plasmid pCJDM210L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
558. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP023544 (Campylobacter jejuni strain CFSAN032806 plasmid pCFSAN032806, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
559. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017854 (Campylobacter jejuni strain ZP3204 plasmid pCJDM204L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
560. spacer 1.65|39786|30|NC_006908|PILER-CR matches to CP002030 (Campylobacter jejuni subsp. jejuni ICDCCJ07001 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
561. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP022471 (Campylobacter jejuni strain jejuni plasmid pRM1246_ERRC, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
562. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017418 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
563. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017419 (Campylobacter jejuni strain MTVDSCj16 plasmid pMTVDSCj16-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
564. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017866 (Campylobacter coli strain YF2105 plasmid pCCDM105L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
565. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017879 (Campylobacter coli strain BG2108 plasmid pCCDM108L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
566. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
567. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017872 (Campylobacter coli strain BP3183 plasmid pCCDM183, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
568. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP020775 (Campylobacter jejuni strain YH002 plasmid pCJP002, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
569. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_022355 (Campylobacter coli CVM N29710 plasmid pN29710-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
570. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_KJ646012 (Campylobacter jejuni strain 11601MD plasmid p11601MD, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
571. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP045793 (Campylobacter coli strain CFSAN032805 plasmid p1CFSAN032805, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
572. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_017282 (Campylobacter jejuni subsp. jejuni S3 plasmid pTet, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
573. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP013035 (Campylobacter coli strain HC2-48 plasmid pccdm1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
574. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP007752 (Campylobacter jejuni subsp. jejuni D42a plasmid pTet-D42a, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
575. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
576. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP023546 (Campylobacter coli strain CFSAN032805 plasmid pCFSAN032805_1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
577. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
578. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP011017 (Campylobacter coli strain FB1 plasmid pFB1TET, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
579. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017030 (Campylobacter jejuni subsp. jejuni strain 14980A plasmid pCJ14980A, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
580. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
581. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017877 (Campylobacter coli strain ZV1224 plasmid pCCDM224L, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
582. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP044168 (Campylobacter jejuni strain AR-0415 plasmid pAR-0415, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
583. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP040609 (Campylobacter sp. CFSAN093226 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
584. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP017861 (Campylobacter jejuni strain TS1218 plasmid pCJDM218, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
585. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP043764 (Campylobacter jejuni strain BfR-CA-14430 plasmid pBfR-CA-14430, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
586. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP007750 (Campylobacter jejuni subsp. jejuni M129 plasmid pTet-M129, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttgac Protospacer
************** .******* . **.
587. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_CP048762 (Campylobacter jejuni strain ZS004 plasmid pCJFEX, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
588. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_MK541988 (Campylobacter coli strain CVM N61740F plasmid pN61740F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
589. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_MK541989 (Campylobacter coli strain CVM N61925F plasmid pN61925F, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
590. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
atttatcttgcaatgcttggagtaaaatta-- CRISPR spacer
atttatcttgcaatttttggagt--gtttggc Protospacer
************** .******* . **.
591. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
ggactttagaatatgatagtatttttaaag Protospacer
. ..************** ** *******.
592. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP015334 (Borrelia hermsii HS1 isolate Browne Mountain plasmid lpG27, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
actttttagaatctgatattaatttatcat Protospacer
*. ********* ************ *
593. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NC_019772 (Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aagttttagaaaatgatattaatagtgtag Protospacer
* ********* *********** *. *.
594. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
595. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP043831 (Bacillus sp. BS98 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
596. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
597. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 7, identity: 0.767
atgttttagaatatgatattaattttaaaa CRISPR spacer
aaaagttaaaatatgatattaattataata Protospacer
* . ***.*************** *** *
598. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
599. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
600. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
601. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
602. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
603. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP019065 (Rahnella sp. ERMR1:05 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
catgaagtgtagaaaaaaaattatttctgg Protospacer
.** ********* **********.*.*..
604. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.767
tattaagtgtagataaaaaattatctttaa CRISPR spacer
cataagctgtagataaaatattatcttttg Protospacer
.** *. *********** ********* .
605. spacer 1.72|40248|30|NC_006908|PILER-CR matches to NC_013862 (Allochromatium vinosum DSM 180 plasmid pALVIN02, complete sequence) position: , mismatch: 7, identity: 0.767
tgtaggttatacagttgctttaaatactta CRISPR spacer
gccagtttatacagttgctttgaatactcg Protospacer
.** ***************.******..
606. spacer 1.73|40314|30|NC_006908|PILER-CR matches to MH617467 (Inoviridae sp. isolate ctba17, complete genome) position: , mismatch: 7, identity: 0.767
caatgcagcactatttagaaaatgatttaa--- CRISPR spacer
caatgccgaactatttagaaa---atctagacc Protospacer
****** * ************ **.**.
607. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_CP015177 (Bacillus thuringiensis serovar alesti strain BGSC 4C1 plasmid pBMB267, complete sequence) position: , mismatch: 7, identity: 0.767
tttaattttgcgctatctttaattttttta CRISPR spacer
actaattttgcgccatccttaattttatgg Protospacer
.***********.***.******** * .
608. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_CP018188 (Streptococcus salivarius strain ICDC2 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
tttaattttgcgctatctttaattttttta CRISPR spacer
agtttttttgcgctatttttaatgtttttt Protospacer
* ***********.****** *****
609. spacer 1.76|40512|30|NC_006908|PILER-CR matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
tagtagagaattagatttattactaaatga Protospacer
*. ..***** ****** ***********
610. spacer 1.76|40512|30|NC_006908|PILER-CR matches to CP016970 (Staphylococcus epidermidis strain DAR1907 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
cataaaagaaggagattttttactaagaaa Protospacer
* *.***** ***************. .*
611. spacer 1.76|40512|30|NC_006908|PILER-CR matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
tacagaagaattagatattttactaatata Protospacer
* ******** **** ********* *
612. spacer 1.76|40512|30|NC_006908|PILER-CR matches to NZ_CP024445 (Moraxella osloensis strain NP7 plasmid pNP7-2, complete sequence) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
gactgaagaaagagattttttactatctca Protospacer
.* ****** ************** * *
613. spacer 1.76|40512|30|NC_006908|PILER-CR matches to NZ_AP018283 (Chondrocystis sp. NIES-4102 plasmid plasmid2 DNA, complete genome) position: , mismatch: 7, identity: 0.767
aaaagaagaatgagattttttactaaatga CRISPR spacer
aaaagaagaataagatttttttgtataact Protospacer
***********.********* ** *
614. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
ggtgttcttgcaaaacttggagtaaaatat Protospacer
. * ******** .*************
615. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to AF424781 (Staphylococcus aureus phage phi 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
616. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to NC_004615 (Staphylococcus phage 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
617. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
ggtgttcttgcaaaacttggagtaaaatat Protospacer
. * ******** .*************
618. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to AF424781 (Staphylococcus aureus phage phi 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
619. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to NC_004615 (Staphylococcus phage 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
620. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
621. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
622. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014345 (Campylobacter jejuni strain RM3194 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
623. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
624. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
625. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017417 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-2, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
626. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
atgttttagaatatgattttaagaacgtac Protospacer
***************** **** .. *
627. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
628. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
629. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
630. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
631. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
632. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
633. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
634. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
635. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
636. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to MN693713 (Marine virus AFVG_250M788, complete genome) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
gtcgtttagtatatgatatgaattttagtt Protospacer
.* ***** ********* *******.
637. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaat---tttaaaa CRISPR spacer
catttatagaatatgatattaattgatttg--- Protospacer
** ***************** ***.
638. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
gattaattgtagataaaaaaatatcagagt Protospacer
***** ************* **** .
639. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
gattaattgtagataaaaaaatatcagagt Protospacer
***** ************* **** .
640. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740797 (Lactococcus Phage ASCC365, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
641. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740813 (Lactococcus Phage ASCC532, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
642. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740789 (Lactococcus Phage ASCC281, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
643. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740796 (Lactococcus Phage ASCC358, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
644. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740790 (Lactococcus Phage ASCC284, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
645. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740792 (Lactococcus Phage ASCC310, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
646. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NC_021855 (Lactococcus phage phi7, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
647. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to JQ740795 (Lactococcus Phage ASCC356, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
648. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to MN693323 (Marine virus AFVG_25M87, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
atctaaatatagataaaaaattatctaaac Protospacer
.***.*.***************** *
649. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MK907268 (Escherichia phage vB_EcoS-26175II, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
650. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
651. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
652. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
653. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP018322 (Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
654. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MK907271 (Escherichia phage vB_EcoS-26175V, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
655. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to KX017521 (Salmonella phage 118970_sal2, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
656. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MK907269 (Escherichia phage vB_EcoS-26175III, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
657. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MK907267 (Escherichia phage vB_EcoS-26175I, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
658. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MK907270 (Escherichia phage vB_EcoS-26175IV, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
659. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to MN197465 (Salmonella phage 2-3, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
660. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NC_031902 (Salmonella phage 100268_sal2, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
661. spacer 1.8|40115|30|NC_006908|CRISPRCasFinder,CRT matches to NC_048149 (Salmonella phage 1-23, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
662. spacer 1.10|40247|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaggttatacagttgctttaaatactta CRISPR spacer
tgcaggttatacagttgatttaaaagacat Protospacer
**.************** ****** . .
663. spacer 1.10|40247|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP039147 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-4, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaggttatacagttgctttaaatactta CRISPR spacer
tcgattcaatacagttgcttaaaatacttt Protospacer
* * . ************ ********
664. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 8, identity: 0.733
tttaattttgcgctatctttaattttttta CRISPR spacer
gcgataaatgagctatctttaattttttta Protospacer
. * ** *******************
665. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045341 (Vibrio sp. THAF190c plasmid pTHAF190c_c, complete sequence) position: , mismatch: 8, identity: 0.733
tttaagaaacatagaaaataatcaatatga CRISPR spacer
agtaagaaacatagaaaatagtaaaacggc Protospacer
******************.* ** *
666. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to MF036691 (Serratia phage CBH8, complete genome) position: , mismatch: 8, identity: 0.733
tttaagaaacatagaaaataatcaatatga CRISPR spacer
aggaagaaagagagaaaataatcaatggaa Protospacer
****** * **************. .*
667. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to MF036690 (Serratia phage CHI14, complete genome) position: , mismatch: 8, identity: 0.733
tttaagaaacatagaaaataatcaatatga CRISPR spacer
aggaagaaagagagaaaataatcaatggaa Protospacer
****** * **************. .*
668. spacer 1.17|40708|30|NC_006908|CRISPRCasFinder,CRT matches to MF036692 (Serratia phage X20, complete genome) position: , mismatch: 8, identity: 0.733
tttaagaaacatagaaaataatcaatatga CRISPR spacer
aggaagaaagagagaaaataatcaatggaa Protospacer
****** * **************. .*
669. spacer 1.18|40774|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MH572377 (Microviridae sp. isolate SD_SC_123, complete genome) position: , mismatch: 8, identity: 0.733
tacaaagaccagaactaataggagcatttt CRISPR spacer
tacaacgtccagaactaataggaagctcaa Protospacer
***** * ***************. *.
670. spacer 1.21|40972|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN694326 (Marine virus AFVG_250M910, complete genome) position: , mismatch: 8, identity: 0.733
agtggaggttttagacaatgaagtagataa CRISPR spacer
tgaggaggttttagactatgaaggagggcc Protospacer
* ************* ****** **.
671. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
aaatagtagataaagtaattaaagatcttg Protospacer
.* ********** ********** * .
672. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080592 (UNVERIFIED: Staphylococcus phage vB_SauM_EW3, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
673. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080603 (UNVERIFIED: Staphylococcus phage vB_SauM_EW9, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
674. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080598 (UNVERIFIED: Staphylococcus phage vB_SauM_EW6, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
675. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080599 (UNVERIFIED: Staphylococcus phage vB_SauM_EW7, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
676. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693089 (Marine virus AFVG_25M562, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
caccagaagataatgtaattaaagtagact Protospacer
*..** ******.*************
677. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080583 (UNVERIFIED: Staphylococcus phage vB_SauM_EW13, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
678. spacer 1.22|41038|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT080597 (UNVERIFIED: Staphylococcus phage vB_SauM_EW5, complete genome) position: , mismatch: 8, identity: 0.733
gattagtagataacgtaattaaagtagtaa CRISPR spacer
taaatatagataacagaattaaagtagtag Protospacer
* .********. *************.
679. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 8, identity: 0.733
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
tttgaaaccaaatctaaatttgaatttaag Protospacer
. ** ************** ******.
680. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_011247 (Borrelia duttonii Ly plasmid pl165, complete sequence) position: , mismatch: 8, identity: 0.733
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
tttgaaaccaaatctaaatttgaatttaag Protospacer
. ** ************** ******.
681. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KP064094 (Enterobacteria phage CAjan, complete genome) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa CRISPR spacer
agaattaactccagaagttattgcacaagt Protospacer
******* * ************** .
682. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039210 (Piscirickettsia salmonis strain Psal-103 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
683. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048067 (Piscirickettsia salmonis strain Ps-8079A plasmid Ps8079A-p1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
684. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038894 (Piscirickettsia salmonis strain Psal-006a plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
685. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038953 (Piscirickettsia salmonis strain Psal-040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
686. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013779 (Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
687. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039042 (Piscirickettsia salmonis strain Psal-072 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
688. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038948 (Piscirickettsia salmonis strain Psal-028 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
689. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039036 (Piscirickettsia salmonis strain Psal-071 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
690. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038963 (Piscirickettsia salmonis strain Psal-051 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
691. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038924 (Piscirickettsia salmonis strain Psal-011 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
692. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039196 (Piscirickettsia salmonis strain Psal-161 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
693. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013769 (Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
694. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013276 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-1-360K, complete sequence) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa-- CRISPR spacer
acaattaaatgcagaaattattg--atgggtt Protospacer
**************.****** ** ..
695. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013761 (Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
696. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013774 (Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
697. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039722 (Bacillus thuringiensis strain BT-59 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa-- CRISPR spacer
acaattaaatgcagaaattattg--atgggtt Protospacer
**************.****** ** ..
698. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050945 (Piscirickettsia salmonis strain Ps-2192A plasmid Ps2192A-p7, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
699. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038892 (Piscirickettsia salmonis strain Psal-005 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
700. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039202 (Piscirickettsia salmonis strain Psal-163 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
701. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009349 (Bacillus thuringiensis HD1002 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa-- CRISPR spacer
acaattaaatgcagaaattattg--atgggtt Protospacer
**************.****** ** ..
702. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039187 (Piscirickettsia salmonis strain Psal-159 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
703. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038933 (Piscirickettsia salmonis strain Psal-025 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
704. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038973 (Piscirickettsia salmonis strain Psal-069 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
705. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039066 (Piscirickettsia salmonis strain Psal-107 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaatt----aaatgcagaagttattgcaattaa CRISPR spacer
----ttctggaaatgcagaagttcttgcaatcgg Protospacer
** ************* *******...
706. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045023 (Bacillus thuringiensis strain JW-1 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa-- CRISPR spacer
acaattaaatgcagaaattattg--atgggtt Protospacer
**************.****** ** ..
707. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_016571 (Pseudomonas phage OBP, complete genome) position: , mismatch: 8, identity: 0.733
cgaattaaatgcagaagttattgcaattaa CRISPR spacer
tggtggacttgcagaagttattgcaagtaa Protospacer
.*. * ***************** ***
708. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to NC_003276 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120alpha, complete sequence) position: , mismatch: 8, identity: 0.733
cttcaccatgataatattttgctaattcta CRISPR spacer
gcacaccttgataatattttgctaaagcgc Protospacer
. **** ***************** *
709. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to AP013482 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G18, isolate: uvMED-CGR-U-MedDCM-OCT-S45-C47) position: , mismatch: 8, identity: 0.733
cttcaccatgataatattttgctaattcta CRISPR spacer
tttcgccatgattatattttgctagcgatg Protospacer
.***.******* ***********.. *.
710. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to MH319749 (Marine virus AG-345-F15 Ga0172271_11 genomic sequence) position: , mismatch: 8, identity: 0.733
cttcaccatgataatattttgctaattcta CRISPR spacer
cttcaccataatgatattttgctttacgaa Protospacer
*********.**.********** . *
711. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP021671 (Bacillus licheniformis strain SRCM100141 plasmid pBL141-1 sequence sequence) position: , mismatch: 8, identity: 0.733
tcattgtataatctttttttcaatttgtat CRISPR spacer
atatcggataatctttttttcaattcttcg Protospacer
.**.* ******************. *
712. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
713. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
714. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
715. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP043059 (Dolichospermum sp. UHCC 0315A plasmid pUHCC0315c, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
aacacaatttattacataaaataatgtaat Protospacer
************** .*******. *
716. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
717. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
718. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
719. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
720. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
721. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
722. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
ttaaaaatttattacaaaaaataaaaaagt Protospacer
.. * ************.****** ***
723. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to MN694311 (Marine virus AFVG_250M573, complete genome) position: , mismatch: 8, identity: 0.733
cccacaatttattacaagaaataataaaca CRISPR spacer
tgaaaaatatattacaagaaatattaaatg Protospacer
. * *** ************** ****..
724. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to MK721191 (Enterococcus phage vB_EfaS_Ef5.4, complete genome) position: , mismatch: 8, identity: 0.733
atatattattatactatcaaaataatacat CRISPR spacer
cgctattattatactatacaaataatctag Protospacer
************** ******* .*
725. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to JX193904 (Enterococcus phage EfaCPT1, complete genome) position: , mismatch: 8, identity: 0.733
atatattattatactatcaaaataatacat CRISPR spacer
cgctattattatactatacaaataatctag Protospacer
************** ******* .*
726. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to MN694115 (Marine virus AFVG_250M901, complete genome) position: , mismatch: 8, identity: 0.733
agtattaactcctgtaattctaattaaatg CRISPR spacer
agtattaactgctgtcattctaaggctacc Protospacer
********** **** ******* *.
727. spacer 1.39|42160|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045299 (Kosakonia arachidis strain KACC 18508 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aatatcttctcttgttgtatatcattcgtc CRISPR spacer
tgaaccttcgcttgttgtatatcatccgca Protospacer
. *.**** ***************.**.
728. spacer 1.40|42226|30|NC_006908|CRISPRCasFinder,CRT matches to MT254578 (Bacillus phage Izhevsk, complete genome) position: , mismatch: 8, identity: 0.733
atattatagttagtagtttcttctttattc CRISPR spacer
ggtttcttgttagtagtttcttctttctct Protospacer
. ** * ****************** *..
729. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tttttataataactatatttgctttttaaa Protospacer
* *************.********.
730. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tttttataataactatatttgctttttaaa Protospacer
* *************.********.
731. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tttttataataactatatttgctttttaaa Protospacer
* *************.********.
732. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tttttataataactatatttgctttttaaa Protospacer
* *************.********.
733. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KF669663 (Bacillus phage Staley, complete genome) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cgctgaaaataactatatttgctttttcaa Protospacer
. *** ***********.********
734. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_022774 (Bacillus phage Slash, complete genome) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cgctgaaaataactatatttgctttttcga Protospacer
. *** ***********.********
735. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tttttataataactatatttgctttttaaa Protospacer
* *************.********.
736. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019166 (Listeria monocytogenes strain HPB5415 plasmid pLM5578, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
737. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU513859 (Listeria monocytogenes strain IZSAM_Lm_15_17439_A144 plasmid pLmA144, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
738. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_022045 (Listeria monocytogenes strain N1-011A plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
739. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_022045 (Listeria monocytogenes strain N1-011A plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
740. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK134858 (Listeria monocytogenes plasmid pLM1686, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
741. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025561 (Listeria monocytogenes strain PIR00545 plasmid pPIR00545, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
742. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045744 (Listeria innocua strain CFSAN044836 plasmid pCFSAN044836, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
743. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014251 (Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
744. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025569 (Listeria monocytogenes strain PIR00540 plasmid pPIR00540, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
745. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015985 (Listeria monocytogenes strain 2015TE24968 plasmid pl2015TE24968, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
746. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG813248 (Listeria monocytogenes R479a plasmid pLMR479a, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
747. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
748. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_021828 (Listeria monocytogenes strain R2-502 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
749. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041214 (Listeria monocytogenes strain LMP18-H8393 plasmid pCFSAN074382, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
750. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_028666 (Streptococcus phage Str-PAP-1, complete genome) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
acacggaaataactttatctgctttttgac Protospacer
. *.*. ******* ************* .
751. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022021 (Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
752. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022021 (Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
753. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023753 (Listeria monocytogenes strain AT3E plasmid pLM58, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
754. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025439 (Listeria monocytogenes strain MF4697 plasmid pMF4697, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
755. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023053 (Listeria monocytogenes strain FDA709873-31 plasmid pCFSAN021143, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
756. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_013767 (Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
757. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_014634 (Ilyobacter polytropus DSM 2926 plasmid pILYOP02, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
tattgaaaataactatatctccttttgtaa Protospacer
* *** ************* *****
758. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021332 (Maritalea myrionectae strain HL2708#5 plasmid pHL2708Y3, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
gcgtgataataataatatctgcttttcaga Protospacer
* .*********. ************..
759. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_014495 (Listeria monocytogenes serotype 1-2b str. SLCC2755 plasmid pLM1-2bUG1 complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
760. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
761. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013725 (Listeria monocytogenes strain Lm N1546 plasmid pLmN1546, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
762. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025260 (Listeria monocytogenes strain MF4624 plasmid pMF4624, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
763. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025083 (Listeria monocytogenes strain MF4626 plasmid pMF4626, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
764. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023051 (Listeria monocytogenes strain FDA971911-001-001 plasmid pCFSAN059932, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
765. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045973 (Listeria monocytogenes strain AUSMDU00000224 plasmid pAUSMDU00000224_01, complete sequence) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
cactgataataactgtatctgcttcgtaag Protospacer
* ***********.*********. *.
766. spacer 1.42|42358|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK448746 (Streptococcus phage Javan383, complete genome) position: , mismatch: 8, identity: 0.733
gaatgataataactatatctgctttttgct CRISPR spacer
acacggaaataactttatctgctttttgac Protospacer
. *.*. ******* ************* .
767. spacer 1.50|42886|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN830257 (Lactobacillus phage JNU_P11, complete genome) position: , mismatch: 8, identity: 0.733
gctgactgttctttgttgtttgtttcattt CRISPR spacer
attgactgttcttttttgtttgtctcccaa Protospacer
..************ ********.** .
768. spacer 1.54|43150|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014149 (Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence) position: , mismatch: 8, identity: 0.733
tcacgaagttttatgaaaagaaattgaaaa CRISPR spacer
gcactaagatttatgaaaagaaataaatgg Protospacer
*** *** *************** .* ..
769. spacer 1.54|43150|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP016195 (Bacillus thuringiensis serovar coreanensis strain ST7 plasmid pST7-1, complete sequence) position: , mismatch: 8, identity: 0.733
tcacgaagttttatgaaaagaaattgaaaa CRISPR spacer
ggaaagggtattatgaaaataaattgaaaa Protospacer
* ...** ********* **********
770. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN879503 (Candidatus Protochlamydia naegleriophila strain KNic plasmid pPNK, complete sequence) position: , mismatch: 8, identity: 0.733
ctaatttatcaaatgaaattgttaatttat CRISPR spacer
tgcctttttcaaatcaaattgttaattctt Protospacer
. *** ****** ************. *
771. spacer 1.56|43282|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_014756 (Sulfuricurvum kujiense DSM 16994 plasmid pSULKU03, complete sequence) position: , mismatch: 8, identity: 0.733
cctacgcttgcaacttttaaattcgtcata CRISPR spacer
aatacacttgcaacttttaatttcggagga Protospacer
***.************** **** . *
772. spacer 1.57|43348|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to LR588166 (Pseudomonas phage vB_PaeM_MIJ3) position: , mismatch: 8, identity: 0.733
ataggtcagattttttctaatgcacccttt CRISPR spacer
gtcatacacattttttctaaagcacccttc Protospacer
.* . ** *********** ********.
773. spacer 1.57|43348|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MH121069 (Pseudomonas phage vB_PaeM_PA5oct, complete genome) position: , mismatch: 8, identity: 0.733
ataggtcagattttttctaatgcacccttt CRISPR spacer
gtcatacacattttttctaaagcacccttc Protospacer
.* . ** *********** ********.
774. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_011246 (Borrelia recurrentis A1 plasmid pl124, complete sequence) position: , mismatch: 8, identity: 0.733
tgattatataagagagcaccaaaatgctta CRISPR spacer
agattatataagagagtatcaaaacacact Protospacer
***************.*.*****..* .
775. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_011247 (Borrelia duttonii Ly plasmid pl165, complete sequence) position: , mismatch: 8, identity: 0.733
tgattatataagagagcaccaaaatgctta CRISPR spacer
agattatataagagagtatcaaaacacact Protospacer
***************.*.*****..* .
776. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014325 (Borrelia anserina Es isolate UTHSCSA plasmid lpA89, complete sequence) position: , mismatch: 8, identity: 0.733
tgattatataagagagcaccaaaatgctta CRISPR spacer
agattatataagagaataccaaaaaacact Protospacer
**************..******* .* .
777. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MH203383 (Ecterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 8, identity: 0.733
tgattatataagagagcaccaaaatgctta CRISPR spacer
tgattatataagagagaatcaaatcccagt Protospacer
**************** *.**** . *
778. spacer 1.58|43414|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_042126 (Enterococcus phage vB_EfaS_AL3, complete genome) position: , mismatch: 8, identity: 0.733
tgattatataagagagcaccaaaatgctta CRISPR spacer
tgattatataagagagaatcaaatcccagt Protospacer
**************** *.**** . *
779. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029457 (Bacillus cereus strain FORC087 plasmid pFORC087.3, complete sequence) position: , mismatch: 8, identity: 0.733
atatattattttaatggtaatttaatacat CRISPR spacer
cctaattattttaatgttaattcaatattt Protospacer
. ************ *****.****. *
780. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to CP013001 (Bacillus thuringiensis strain XL6 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
ttttaatagtaaataataaattattattaa Protospacer
. *** ******************.* .
781. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaatggtaaaaaataaattattagaaa Protospacer
. ***** ***** ************ .
782. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
tgactattgtcaataataaattattatcta Protospacer
* ***** ***************..*.
783. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
ttaaaattgtaaattataaattaagttttt Protospacer
.************ ******** .**
784. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
ttaaaattgtaaattataaattaagttttt Protospacer
.************ ******** .**
785. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041396 (Bacteroides ovatus strain 3725 D1 iv plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
acaaaattgtaaataataaattattacttg CRISPR spacer
gaaaaatagtaaataatacattattctgta Protospacer
. ***** ********** ****** . *.
786. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
ggtgttcttgcaaaacttggagtaaaatat Protospacer
. * ******** .*************
787. spacer 1.64|39720|30|NC_006908|PILER-CR matches to AF424781 (Staphylococcus aureus phage phi 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
788. spacer 1.64|39720|30|NC_006908|PILER-CR matches to NC_004615 (Staphylococcus phage 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
789. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
ggtgttcttgcaaaacttggagtaaaatat Protospacer
. * ******** .*************
790. spacer 1.65|39786|30|NC_006908|PILER-CR matches to AF424781 (Staphylococcus aureus phage phi 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
791. spacer 1.65|39786|30|NC_006908|PILER-CR matches to NC_004615 (Staphylococcus phage 11, complete genome) position: , mismatch: 8, identity: 0.733
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tccaatcttgcaatgctttgagtacaactt Protospacer
.. ************** ***** **.*
792. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP028373 (Campylobacter jejuni subsp. jejuni strain huA17 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
793. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP014745 (Campylobacter jejuni strain OD267 plasmid pCJDM67 L, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
794. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP014345 (Campylobacter jejuni strain RM3194 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
795. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP014743 (Campylobacter jejuni strain WP2202 plasmid pCJDM202, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
796. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
797. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP017417 (Campylobacter jejuni strain MTVDSCj13 plasmid pMTVDSCj13-2, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
798. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
atgttttagaatatgattttaagaacgtac Protospacer
***************** **** .. *
799. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP044174 (Campylobacter jejuni strain AR-0412 plasmid pAR-0412, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
800. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
801. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP018901 (Campylobacter coli strain YH502 plasmid pCOS502, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
802. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
803. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP017026 (Campylobacter coli plasmid pCC14983A-1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
804. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
805. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP044176 (Campylobacter coli strain AR-0411 plasmid pAR-0411, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
806. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
807. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP025282 (Campylobacter coli strain YH503 plasmid pCOS503, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
tagaaaaagaatatgatattaaatttaaag Protospacer
* *************** ******.
808. spacer 1.68|39984|30|NC_006908|PILER-CR matches to MN693713 (Marine virus AFVG_250M788, complete genome) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaattttaaaa CRISPR spacer
gtcgtttagtatatgatatgaattttagtt Protospacer
.* ***** ********* *******.
809. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP029140 (Klebsiella michiganensis strain AR375 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
atgttttagaatatgatattaat---tttaaaa CRISPR spacer
catttatagaatatgatattaattgatttg--- Protospacer
** ***************** ***.
810. spacer 1.69|40050|30|NC_006908|PILER-CR matches to KF148616 (Campylobacter phage CP8, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
gattaattgtagataaaaaaatatcagagt Protospacer
***** ************* **** .
811. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NC_042112 (Campylobacter phage CP81, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
gattaattgtagataaaaaaatatcagagt Protospacer
***** ************* **** .
812. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740797 (Lactococcus Phage ASCC365, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
813. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740813 (Lactococcus Phage ASCC532, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
814. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740789 (Lactococcus Phage ASCC281, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
815. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740796 (Lactococcus Phage ASCC358, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
816. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740790 (Lactococcus Phage ASCC284, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
817. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740792 (Lactococcus Phage ASCC310, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
818. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NC_021855 (Lactococcus phage phi7, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
819. spacer 1.69|40050|30|NC_006908|PILER-CR matches to JQ740795 (Lactococcus Phage ASCC356, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
attctagtgaagataaaaaattatattttg Protospacer
*. **** ************** *** .
820. spacer 1.69|40050|30|NC_006908|PILER-CR matches to MN693323 (Marine virus AFVG_25M87, complete genome) position: , mismatch: 8, identity: 0.733
tattaagtgtagataaaaaattatctttaa CRISPR spacer
atctaaatatagataaaaaattatctaaac Protospacer
.***.*.***************** *
821. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MK907268 (Escherichia phage vB_EcoS-26175II, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
822. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
823. spacer 1.70|40116|30|NC_006908|PILER-CR matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
824. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
825. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NZ_CP018322 (Alteromonas macleodii strain Te101 plasmid pTE101a, complete sequence) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
acgacttacagaatggataatcaaatcaat Protospacer
* .**** ****** ***********
826. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MK907271 (Escherichia phage vB_EcoS-26175V, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
827. spacer 1.70|40116|30|NC_006908|PILER-CR matches to KX017521 (Salmonella phage 118970_sal2, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
828. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MK907269 (Escherichia phage vB_EcoS-26175III, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
829. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MK907267 (Escherichia phage vB_EcoS-26175I, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
830. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MK907270 (Escherichia phage vB_EcoS-26175IV, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
831. spacer 1.70|40116|30|NC_006908|PILER-CR matches to MN197465 (Salmonella phage 2-3, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
832. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NC_031902 (Salmonella phage 100268_sal2, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
833. spacer 1.70|40116|30|NC_006908|PILER-CR matches to NC_048149 (Salmonella phage 1-23, complete genome) position: , mismatch: 8, identity: 0.733
aattactacataatggaaaatcaaatcaaa CRISPR spacer
ctgttcaacataatggaaaatcaaaacatc Protospacer
* * ****************** **
834. spacer 1.72|40248|30|NC_006908|PILER-CR matches to NZ_CP032532 (Bacillus megaterium NCT-2 plasmid pNCT2_4, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaggttatacagttgctttaaatactta CRISPR spacer
tgcaggttatacagttgatttaaaagacat Protospacer
**.************** ****** . .
835. spacer 1.72|40248|30|NC_006908|PILER-CR matches to NZ_CP039147 (Acinetobacter sp. 10FS3-1 plasmid p10FS3-1-4, complete sequence) position: , mismatch: 8, identity: 0.733
tgtaggttatacagttgctttaaatactta CRISPR spacer
tcgattcaatacagttgcttaaaatacttt Protospacer
* * . ************ ********
836. spacer 1.75|40446|30|NC_006908|PILER-CR matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 8, identity: 0.733
tttaattttgcgctatctttaattttttta CRISPR spacer
gcgataaatgagctatctttaattttttta Protospacer
. * ** *******************
837. spacer 1.5|39917|30|NC_006908|CRISPRCasFinder,CRT matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 9, identity: 0.7
tgaatctcttcttcgtttaatgtatcacgt CRISPR spacer
aatttctcaccttcgtttaatgtatcaacc Protospacer
. **** .***************** .
838. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.7
atgttttagaatatgatattaattttaaaa CRISPR spacer
taaggcaaaaaaatgatattaattttaaaa Protospacer
. . *.** ******************
839. spacer 1.6|39983|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.7
atgttttagaatatgatattaattttaaaa CRISPR spacer
taaggcaaaaaaatgatattaattttaaaa Protospacer
. . *.** ******************
840. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to MF448557 (Lactococcus phage 37201, complete genome) position: , mismatch: 9, identity: 0.7
tattaagtgtagataaaaaattatctttaa CRISPR spacer
atcctagtgaagataaaaaattatattttg Protospacer
.. **** ************** *** .
841. spacer 1.11|40313|30|NC_006908|CRISPRCasFinder,CRT matches to NC_048171 (Synechococcus phage S-B28, complete genome) position: , mismatch: 9, identity: 0.7
caatgcagcactatttagaaaatgatttaa CRISPR spacer
aagctattcactatttagaaaatgagttac Protospacer
*.. ***************** ***
842. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to MF036691 (Serratia phage CBH8, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
843. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to MF036690 (Serratia phage CHI14, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
844. spacer 1.13|40445|30|NC_006908|CRISPRCasFinder,CRT matches to MF036692 (Serratia phage X20, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
845. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KY554772 (Lactococcus phage AM5, complete genome) position: , mismatch: 9, identity: 0.7
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
gaattaatcaaatctaaatttgaatcatgg Protospacer
. ***** ************** **. ..
846. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_049856 (Lactococcus phage AM4, complete genome) position: , mismatch: 9, identity: 0.7
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
gaattaatcaaatctaaatttgaatcatgg Protospacer
. ***** ************** **. ..
847. spacer 1.24|41170|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_049856 (Lactococcus phage AM4, complete genome) position: , mismatch: 9, identity: 0.7
acattaaacaaatctaaatttgcatttaaa CRISPR spacer
gaattaatcaaatctaaatttgaatcatgg Protospacer
. ***** ************** **. ..
848. spacer 1.25|41236|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MN693515 (Marine virus AFVG_25M70, complete genome) position: , mismatch: 9, identity: 0.7
cgaattaaatgcagaagttattgcaattaa CRISPR spacer
tttattaaatccagaagttattgcatagtg Protospacer
. ******* ************** .
849. spacer 1.28|41434|30|NC_006908|CRISPRCasFinder,CRT matches to AP022644 (Bacillus wiedmannii PL1 plasmid pBwiPL1-1 DNA, complete sequence) position: , mismatch: 9, identity: 0.7
cttcaccatgataatattttgctaattcta CRISPR spacer
taaattcattataatatttttctaattctt Protospacer
. .*** ********** ********
850. spacer 1.29|41500|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014361 (Methylomonas sp. DH-1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.7
tcattgtataatctttttttcaatttgtat CRISPR spacer
aatttgtttattctttttttcaattttcgc Protospacer
**** ** *************** ...
851. spacer 1.32|41698|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_LT667504 (Buchnera aphidicola (Cinara confinis) strain BCiconfinis isolate 2801 plasmid pLeuTrp) position: , mismatch: 9, identity: 0.7
cccacaatttattacaagaaataataaaca CRISPR spacer
taataaatttattaaaagaaataaaaaaac Protospacer
. ********* ********* ***
852. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 9, identity: 0.7
atatattattatactatcaaaataatacat CRISPR spacer
accctactttatactatcaacataatacaa Protospacer
*. . . ************ ********
853. spacer 1.33|41764|30|NC_006908|CRISPRCasFinder,CRT matches to MN693011 (Marine virus AFVG_117M58, complete genome) position: , mismatch: 9, identity: 0.7
atatattattatactatcaaaataatacat CRISPR spacer
cccccgcattatacaatcaaaatgatacat Protospacer
. . .******* ********.******
854. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
agtattaactcctgtaattctaattaaatg CRISPR spacer
tttattaactcctttaattataattttcaa Protospacer
*********** ***** ***** .
855. spacer 1.35|41896|30|NC_006908|CRISPRCasFinder,CRT matches to MN693652 (Marine virus AFVG_250M189, complete genome) position: , mismatch: 9, identity: 0.7
agtattaactcctgtaattctaattaaatg CRISPR spacer
tttattaactcctgtaaatctaacagcagc Protospacer
*************** *****. . *
856. spacer 1.36|41962|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP014612 (Leuconostoc mesenteroides subsp. jonggajibkimchii strain DRC1506 plasmid pDRC1, complete sequence) position: , mismatch: 9, identity: 0.7
aagagcaattgatttaagaattttccaacc CRISPR spacer
tgctacaactgatataagaattttccaatt Protospacer
. .***.**** **************..
857. spacer 1.36|41962|30|NC_006908|CRISPRCasFinder,CRT matches to MH552499 (Podoviridae sp. isolate ctcf755, complete genome) position: , mismatch: 9, identity: 0.7
aagagcaattgatttaagaattttccaacc CRISPR spacer
tcaaggaattgatttaagaattttagatga Protospacer
.** ****************** *
858. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017376 (Lactobacillus plantarum strain TMW 1.708 plasmid pL1708-2, complete sequence) position: , mismatch: 9, identity: 0.7
tactggatttgaattaaattttgatgacgg CRISPR spacer
agctagatttgaatttaattttgatatatt Protospacer
.**.********** *********.
859. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT774406 (CrAssphage cr124_1, complete genome) position: , mismatch: 9, identity: 0.7
tactggatttgaattaaattttgatgacgg CRISPR spacer
ccaagggtttgaattagattttgatgattt Protospacer
. **.*********.**********.
860. spacer 1.51|42952|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 9, identity: 0.7
attctgcccaactaataaatcaaaaaaata CRISPR spacer
tagtaaaccaactacaaaatcaaaaaaata Protospacer
. . ******* **************
861. spacer 1.52|43018|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 9, identity: 0.7
tgtctgtatctaaataataaacattttttc CRISPR spacer
aacctgtatctaagtaataaacatcagata Protospacer
..**********.**********. *
862. spacer 1.55|43216|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to KF929199 (Staphylococcus phage vB_SepS_SEP9, complete genome) position: , mismatch: 9, identity: 0.7
ctaatttatcaaatgaaattgttaatttat CRISPR spacer
tagatttatcaactgaaattggtaatagta Protospacer
. .********* ******** ****
863. spacer 1.59|43480|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 9, identity: 0.7
atatattattttaatggtaatttaatacat CRISPR spacer
ggttattatttttatgctaatttaattgtg Protospacer
. ********* *** *********
864. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaattgaaaataataaattatatgaaa Protospacer
******* ************** .
865. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaattgaaaataataaattatatgaaa Protospacer
******* ************** .
866. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaattgaaaataataaattatatgaaa Protospacer
******* ************** .
867. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
taaaaattgaaaataataaattatatgaaa Protospacer
******* ************** .
868. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
acaaaattgtaaaaaagaaattaccgaagc Protospacer
************* ** ******...
869. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
tcaaaattatagataataaattatagacaa Protospacer
*******.**.************ . . .
870. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250019 (Prevotella phage Lak-A2, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
tcaaaattatagataataaattatagacaa Protospacer
*******.**.************ . . .
871. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MT774384 (CrAssphage cr8_1, complete genome) position: , mismatch: 9, identity: 0.7
acaaaattgtaaataataaattattacttg CRISPR spacer
tttaaattgttaataataaattatagtata Protospacer
. ******* ************* .. *.
872. spacer 1.67|39918|30|NC_006908|PILER-CR matches to MN855763 (Myoviridae sp. isolate 210, complete genome) position: , mismatch: 9, identity: 0.7
tgaatctcttcttcgtttaatgtatcacgt CRISPR spacer
aatttctcaccttcgtttaatgtatcaacc Protospacer
. **** .***************** .
873. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.7
atgttttagaatatgatattaattttaaaa CRISPR spacer
taaggcaaaaaaatgatattaattttaaaa Protospacer
. . *.** ******************
874. spacer 1.68|39984|30|NC_006908|PILER-CR matches to NZ_CP031268 (Staphylococcus warneri strain 16A plasmid unnamed2) position: , mismatch: 9, identity: 0.7
atgttttagaatatgatattaattttaaaa CRISPR spacer
taaggcaaaaaaatgatattaattttaaaa Protospacer
. . *.** ******************
875. spacer 1.69|40050|30|NC_006908|PILER-CR matches to MF448557 (Lactococcus phage 37201, complete genome) position: , mismatch: 9, identity: 0.7
tattaagtgtagataaaaaattatctttaa CRISPR spacer
atcctagtgaagataaaaaattatattttg Protospacer
.. **** ************** *** .
876. spacer 1.73|40314|30|NC_006908|PILER-CR matches to NC_048171 (Synechococcus phage S-B28, complete genome) position: , mismatch: 9, identity: 0.7
caatgcagcactatttagaaaatgatttaa CRISPR spacer
aagctattcactatttagaaaatgagttac Protospacer
*.. ***************** ***
877. spacer 1.75|40446|30|NC_006908|PILER-CR matches to MF036691 (Serratia phage CBH8, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
878. spacer 1.75|40446|30|NC_006908|PILER-CR matches to MF036690 (Serratia phage CHI14, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
879. spacer 1.75|40446|30|NC_006908|PILER-CR matches to MF036692 (Serratia phage X20, complete genome) position: , mismatch: 9, identity: 0.7
tttaattttgcgctatctttaattttttta CRISPR spacer
gaatattttgcggtatctttaattttaact Protospacer
******** ************* .
880. spacer 1.2|39719|30|NC_006908|CRISPRCasFinder,CRT matches to MN694524 (Marine virus AFVG_250M563, complete genome) position: , mismatch: 10, identity: 0.667
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tactatcttgcaatgcttgtagtacggagg Protospacer
.**************** **** .. .
881. spacer 1.3|39785|30|NC_006908|CRISPRCasFinder,CRT matches to MN694524 (Marine virus AFVG_250M563, complete genome) position: , mismatch: 10, identity: 0.667
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tactatcttgcaatgcttgtagtacggagg Protospacer
.**************** **** .. .
882. spacer 1.7|40049|30|NC_006908|CRISPRCasFinder,CRT matches to NZ_CP006904 (Clostridium botulinum 202F plasmid pCBI, complete sequence) position: , mismatch: 10, identity: 0.667
tattaagtgtagataaaaaattatctttaa CRISPR spacer
ataaaagtatagataaaaaattatcggagc Protospacer
****.**************** .
883. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 10, identity: 0.667
tactggatttgaattaaattttgatgacgg CRISPR spacer
aggtggatttgaattagattttgaatggaa Protospacer
. *************.******* . ..
884. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 10, identity: 0.667
tactggatttgaattaaattttgatgacgg CRISPR spacer
aggtggatttgaattagattttgaatggaa Protospacer
. *************.******* . ..
885. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 10, identity: 0.667
tactggatttgaattaaattttgatgacgg CRISPR spacer
aggtggatttgaattagattttgaatggaa Protospacer
. *************.******* . ..
886. spacer 1.45|42556|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 10, identity: 0.667
tactggatttgaattaaattttgatgacgg CRISPR spacer
aggtggatttgaattagattttgaatggaa Protospacer
. *************.******* . ..
887. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 10, identity: 0.667
acaaaattgtaaataataaattattacttg CRISPR spacer
tagaaattgaaaataataaattatatgaaa Protospacer
.****** ************** .
888. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 10, identity: 0.667
acaaaattgtaaataataaattattacttg CRISPR spacer
tagaaattgaaaataataaattatatgaaa Protospacer
.****** ************** .
889. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 10, identity: 0.667
acaaaattgtaaataataaattattacttg CRISPR spacer
tagaaattgaaaataataaattatatgaaa Protospacer
.****** ************** .
890. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 10, identity: 0.667
acaaaattgtaaataataaattattacttg CRISPR spacer
tagaaattgaaaataataaattatatgaaa Protospacer
.****** ************** .
891. spacer 1.60|43546|30|NC_006908|CRISPRCasFinder,CRT,PILER-CR matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 10, identity: 0.667
acaaaattgtaaataataaattattacttg CRISPR spacer
tagaaattgaaaataataaattatatgaaa Protospacer
.****** ************** .
892. spacer 1.64|39720|30|NC_006908|PILER-CR matches to MN694524 (Marine virus AFVG_250M563, complete genome) position: , mismatch: 10, identity: 0.667
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tactatcttgcaatgcttgtagtacggagg Protospacer
.**************** **** .. .
893. spacer 1.65|39786|30|NC_006908|PILER-CR matches to MN694524 (Marine virus AFVG_250M563, complete genome) position: , mismatch: 10, identity: 0.667
atttatcttgcaatgcttggagtaaaatta CRISPR spacer
tactatcttgcaatgcttgtagtacggagg Protospacer
.**************** **** .. .
894. spacer 1.69|40050|30|NC_006908|PILER-CR matches to NZ_CP006904 (Clostridium botulinum 202F plasmid pCBI, complete sequence) position: , mismatch: 10, identity: 0.667
tattaagtgtagataaaaaattatctttaa CRISPR spacer
ataaaagtatagataaaaaattatcggagc Protospacer
****.**************** .
