Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_006833 Wolbachia endosymbiont strain TRS of Brugia malayi, complete sequence 1 crisprs cas3 0 1 2 0

Results visualization

1. NC_006833
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_006833_1 99455-99537 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_006833_1 1.1|99484|25|NC_006833|CRISPRCasFinder 99484-99508 25 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 391607-391631 4 0.84
NC_006833_1 1.1|99484|25|NC_006833|CRISPRCasFinder 99484-99508 25 MN693183 Marine virus AFVG_25M360, complete genome 20205-20229 5 0.8

1. spacer 1.1|99484|25|NC_006833|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

ggaaccaccaccggtgccgcctaag	CRISPR spacer
ggaaccaccaccgttgccgccgccg	Protospacer
************* *******   *

2. spacer 1.1|99484|25|NC_006833|CRISPRCasFinder matches to MN693183 (Marine virus AFVG_25M360, complete genome) position: , mismatch: 5, identity: 0.8

ggaaccaccaccggtgccgcctaag	CRISPR spacer
cgaaccaccaccggagccgccttga	Protospacer
 ************* ******* ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 287110 : 299892 11 Cyanophage(25.0%) tRNA NA
DBSCAN-SWA_2 943957 : 1011533 48 Erwinia_phage(10.0%) protease,integrase,tRNA attL 950753:950773|attR 1013102:1013122
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage