Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_000964 Bacillus subtilis subsp. subtilis str. 168 complete genome 3 crisprs csa3,cas3,DEDDh,WYL,DinG 0 1 11 0

Results visualization

1. NC_000964
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000964_1 937945-938050 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000964_2 3172256-3172363 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_000964_3 3714992-3715104 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP024037 Bacillus aryabhattai strain K13 plasmid unnamed2 10417-10476 7 0.883
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP026740 Bacillus megaterium strain YC4-R4 plasmid unnamed4 70764-70823 7 0.883
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NC_017139 Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence 1318-1377 7 0.883
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP010587 Bacillus megaterium Q3 plasmid p1, complete sequence 838-897 7 0.883
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP023319 Bacillus megaterium strain A plasmid p2, complete sequence 75825-75884 7 0.883
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NC_020451 Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence 1960-2019 9 0.85
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP015440 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence 64773-64832 12 0.8
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 483791-483850 13 0.783
NC_000964_2 2.1|3172280|60|NC_000964|CRISPRCasFinder 3172280-3172339 60 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 57361-57420 14 0.767

1. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP024037 (Bacillus aryabhattai strain K13 plasmid unnamed2) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

2. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP026740 (Bacillus megaterium strain YC4-R4 plasmid unnamed4) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

3. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NC_017139 (Bacillus megaterium WSH-002 plasmid WSH-002_p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

4. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP010587 (Bacillus megaterium Q3 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

5. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP023319 (Bacillus megaterium strain A plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.883

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatatttta-aagtggcggt	Protospacer
******************************************  *****   * ****.*

6. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NC_020451 (Vibrio coralliilyticus strain ATCC BAA-450 plasmid, complete sequence) position: , mismatch: 9, identity: 0.85

cagcttggaaggctgaggttttaccactaaactacacccgcaatttttatttggggcgat	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcattttagttatggcccggg	Protospacer
****************************************** ***   * ***  **. 

7. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP015440 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_2, complete sequence) position: , mismatch: 12, identity: 0.8

cagcttggaaggctgaggttttaccactaaactacacccgca-------atttttatttg	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcataataatatataccattg	Protospacer
******************************************       ** * .  ***

8. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 13, identity: 0.783

cagcttggaaggctgaggttttaccactaaactacacccgc--------aatttttattt	CRISPR spacer
cagcttggaaggctgaggttttaccactaaactacacccgcatggttaaaagttttgcca	Protospacer
*****************************************        ** ****... 

9. spacer 2.1|3172280|60|NC_000964|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 14, identity: 0.767

cagcttggaaggctgaggttttaccactaaactacacccgc---------aatttttatt	CRISPR spacer
cagcttggaaggctgtagttttaccactaaactacacccgcatagtaagtagttcttagt	Protospacer
*************** .************************         *.**.*** *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 700231 : 708597 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1207817 : 1251590 48 Planktothrix_phage(25.0%) tRNA,coat NA
DBSCAN-SWA_3 1314452 : 1359285 57 uncultured_Caudovirales_phage(27.78%) terminase,holin,capsid,protease,portal,plate NA
DBSCAN-SWA_4 1724028 : 1770195 39 Bodo_saltans_virus(18.18%) tRNA,coat,protease NA
DBSCAN-SWA_5 1868616 : 1875171 6 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_6 2152085 : 2286408 195 Bacillus_phage(98.88%) lysis,integrase,tail,holin attL 2152048:2152063|attR 2286414:2286429
DBSCAN-SWA_7 2425247 : 2431343 8 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_8 2634504 : 2699243 86 Bacillus_phage(29.27%) capsid,holin,terminase,protease,tail,head,plate NA
DBSCAN-SWA_9 2832726 : 2886043 56 uncultured_Mediterranean_phage(12.5%) tRNA,lysis,coat,protease NA
DBSCAN-SWA_10 3159257 : 3218173 45 uncultured_Caudovirales_phage(57.14%) holin,coat,protease NA
DBSCAN-SWA_11 3459805 : 3468235 11 Organic_Lake_phycodnavirus(100.0%) holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage