Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007504 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV2, complete sequence 0 crisprs NA 0 0 0 0
NC_007505 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV19, complete sequence 0 crisprs NA 0 0 0 0
NC_007506 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV38, complete sequence 0 crisprs NA 0 0 0 0
NC_007507 Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence 0 crisprs NA 0 0 2 0
NC_007508 Xanthomonas campestris pv. vesicatoria str. 85-10, complete genome 5 crisprs WYL,DEDDh,csa3,cas3,DinG 0 4 10 0

Results visualization

1. NC_007507
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23754 : 78688 58 Ralstonia_phage(25.0%) integrase,transposase attL 47467:47481|attR 81187:81201
DBSCAN-SWA_2 99653 : 133605 27 Enterobacteria_phage(33.33%) integrase,transposase attL 102989:103005|attR 138995:139011

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007508
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007508_1 1646352-1646433 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007508_2 1794712-1794832 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007508_3 2442762-2442832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007508_4 2872815-2872886 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007508_5 3632190-3632576 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 KF626665 Phage Sano, complete genome 12494-12523 4 0.867
NC_007508_3 3.1|2442785|25|NC_007508|CRISPRCasFinder 2442785-2442809 25 NC_014842 Pantoea sp. At-9b plasmid pPAT9B05, complete sequence 45680-45704 5 0.8
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4378292-4378321 5 0.833
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 MH622920 Podoviridae sp. isolate ctda_1, complete genome 69862-69891 6 0.8
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 NZ_CP020900 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence 39313-39342 6 0.8
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 MT708549 Burkholderia phage Maja, complete genome 15405-15434 6 0.8
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NC_042345 Phage Salvo, complete genome 11904-11933 6 0.8
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 MT939492 Xanthomonas phage Xoo-sp14, complete genome 66686-66715 6 0.8
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NZ_LN554848 Aliivibrio wodanis genome assembly AWOD1, plasmid : pAWOD920 69416-69445 6 0.8
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 248502-248531 7 0.767
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 274785-274814 7 0.767
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 KU682439 Stenotrophomonas phage vB_SmaS-DLP_6, complete genome 85751-85780 7 0.767
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 MG189906 Stenotrophomonas phage vB_SmaS_DLP_5, complete genome 33605-33634 7 0.767
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 MT110073 Stenotrophomonas phage vB_SmaS_DLP_3, complete genome 32464-32493 7 0.767
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 326936-326965 8 0.733
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5661554-5661583 8 0.733
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 MN013090 Erwinia phage vB_EamM_TropicalSun, complete genome 20087-20116 8 0.733
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 MN062189 Serratia phage MyoSmar, complete genome 43811-43840 8 0.733
NC_007508_5 5.3|3632355|30|NC_007508|CRT 3632355-3632384 30 LC208019 Aeropyrum globular virus 1 genomic DNA, complete genome 15857-15886 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NZ_CP019318 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-6, complete sequence 44104-44133 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NZ_CP018682 Vibrio harveyi isolate QT520 plasmid p1, complete sequence 37863-37892 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NC_048060 Dickeya phage Mysterion, complete genome 19358-19387 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 MH807810 Dickeya phage Dagda_B1, complete genome 18639-18668 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 MH807815 Dickeya phage Luksen, complete genome 19570-19599 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NC_047961 Dickeya phage Dagda, complete genome 18639-18668 9 0.7
NC_007508_5 5.6|3632487|30|NC_007508|CRT 3632487-3632516 30 NC_048057 Dickeya phage Katbat, complete genome 18576-18605 9 0.7
NC_007508_2 2.2|1794782|35|NC_007508|PILER-CR 1794782-1794816 35 NZ_CP020333 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence 127336-127370 10 0.714

1. spacer 5.6|3632487|30|NC_007508|CRT matches to KF626665 (Phage Sano, complete genome) position: , mismatch: 4, identity: 0.867 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
agccttcttgacggccttcttggcggcgat	Protospacer
**.*********************.**..*

2. spacer 3.1|2442785|25|NC_007508|CRISPRCasFinder matches to NC_014842 (Pantoea sp. At-9b plasmid pPAT9B05, complete sequence) position: , mismatch: 5, identity: 0.8 

aattaccgtggtttcaggtaaagag	CRISPR spacer
gcgtaccgtggtttcagataaagaa	Protospacer
.  **************.******.

3. spacer 5.6|3632487|30|NC_007508|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
agccttcttgacggccttcttggccggggc	Protospacer
**.********************* * .*.

4. spacer 5.3|3632355|30|NC_007508|CRT matches to MH622920 (Podoviridae sp. isolate ctda_1, complete genome) position: , mismatch: 6, identity: 0.8 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
agcggtcttcttggttgccttcttgctggt	Protospacer
.**.********************  ..**

5. spacer 5.3|3632355|30|NC_007508|CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 6, identity: 0.8 

ggcagtcttcttggttgccttcttcgcagt-	CRISPR spacer
accagtcttccttgttgccttcttc-cagca	Protospacer
. ********.* ************ ***.

6. spacer 5.3|3632355|30|NC_007508|CRT matches to MT708549 (Burkholderia phage Maja, complete genome) position: , mismatch: 6, identity: 0.8 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
ggtcgtcttcgtggttgccttcgtcgcctt	Protospacer
**. ****** *********** ****  *

7. spacer 5.6|3632487|30|NC_007508|CRT matches to NC_042345 (Phage Salvo, complete genome) position: , mismatch: 6, identity: 0.8 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
agtcttcttggcggccttcttggcggggcg	Protospacer
**********.*************.* .

8. spacer 5.6|3632487|30|NC_007508|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.8 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
ggtcttcttgacagccttcttggccggctt	Protospacer
.***********.*********** *   *

9. spacer 5.6|3632487|30|NC_007508|CRT matches to NZ_LN554848 (Aliivibrio wodanis genome assembly AWOD1, plasmid : pAWOD920) position: , mismatch: 6, identity: 0.8 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
ggccttcttgacggccttcttgacggcctt	Protospacer
.*.*******************.*.**  *

10. spacer 5.3|3632355|30|NC_007508|CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 7, identity: 0.767 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
accagtcttctttgttgccttcttcgagca	Protospacer
. ********** ************* .

11. spacer 5.6|3632487|30|NC_007508|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
gatctccttgacggccttcttggcgtcctt	Protospacer
..***.******************. *  *

12. spacer 5.6|3632487|30|NC_007508|CRT matches to KU682439 (Stenotrophomonas phage vB_SmaS-DLP_6, complete genome) position: , mismatch: 7, identity: 0.767 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
agcgaccttggcggtcttcttggcagcagc	Protospacer
**.  .****.***.**************.

13. spacer 5.6|3632487|30|NC_007508|CRT matches to MG189906 (Stenotrophomonas phage vB_SmaS_DLP_5, complete genome) position: , mismatch: 7, identity: 0.767 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
cgtcttcttgaccaccttcttggcgacctt	Protospacer
 *********** .**********..*  *

14. spacer 5.6|3632487|30|NC_007508|CRT matches to MT110073 (Stenotrophomonas phage vB_SmaS_DLP_3, complete genome) position: , mismatch: 7, identity: 0.767 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
cgtcttcttgacggtcttcttgacgacctt	Protospacer
 *************.*******.*..*  *

15. spacer 5.3|3632355|30|NC_007508|CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 8, identity: 0.733 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
accagtcttccttgttgccttcttcgagca	Protospacer
. ********.* ************* .

16. spacer 5.3|3632355|30|NC_007508|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
cgttggcttcttggtcgccttcttcgcctg	Protospacer
 *. * *********.***********

17. spacer 5.3|3632355|30|NC_007508|CRT matches to MN013090 (Erwinia phage vB_EamM_TropicalSun, complete genome) position: , mismatch: 8, identity: 0.733 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
gttcgtcttcttcgttgacttcttcgcccg	Protospacer
* . ******** **** *********

18. spacer 5.3|3632355|30|NC_007508|CRT matches to MN062189 (Serratia phage MyoSmar, complete genome) position: , mismatch: 8, identity: 0.733 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
gttcgtcttcttcgttgacttcttcgcccg	Protospacer
* . ******** **** *********

19. spacer 5.3|3632355|30|NC_007508|CRT matches to LC208019 (Aeropyrum globular virus 1 genomic DNA, complete genome) position: , mismatch: 9, identity: 0.7 

ggcagtcttcttggttgccttcttcgcagt	CRISPR spacer
tcccagcttcttggttaccttcttcgcctg	Protospacer
  * . **********.**********

20. spacer 5.6|3632487|30|NC_007508|CRT matches to NZ_CP019318 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-6, complete sequence) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
cacgttcttgatggcgttcttggcagcgcg	Protospacer
 .. *******.*** ***********.

21. spacer 5.6|3632487|30|NC_007508|CRT matches to NZ_CP018682 (Vibrio harveyi isolate QT520 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
gaccttcttgacgtccttcttggcgtccaa	Protospacer
...********** **********. * .

22. spacer 5.6|3632487|30|NC_007508|CRT matches to NC_048060 (Dickeya phage Mysterion, complete genome) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
tgtcttcttgaccgccttcttgattttctt	Protospacer
 *********** *********..  .  *

23. spacer 5.6|3632487|30|NC_007508|CRT matches to MH807810 (Dickeya phage Dagda_B1, complete genome) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
tgtcttcttgacagccttcttgattttctt	Protospacer
 ***********.*********..  .  *

24. spacer 5.6|3632487|30|NC_007508|CRT matches to MH807815 (Dickeya phage Luksen, complete genome) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
tgtcttcttgacagccttcttgattttctt	Protospacer
 ***********.*********..  .  *

25. spacer 5.6|3632487|30|NC_007508|CRT matches to NC_047961 (Dickeya phage Dagda, complete genome) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
tgtcttcttgacagccttcttgattttctt	Protospacer
 ***********.*********..  .  *

26. spacer 5.6|3632487|30|NC_007508|CRT matches to NC_048057 (Dickeya phage Katbat, complete genome) position: , mismatch: 9, identity: 0.7 

agtcttcttgacggccttcttggcagcagt	CRISPR spacer
tgtcttcttgacagccttcttgattttctt	Protospacer
 ***********.*********..  .  *

27. spacer 2.2|1794782|35|NC_007508|PILER-CR matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 10, identity: 0.714 

gtcggcgctcactgcggcggccccgttgatctgcg	CRISPR spacer
aagtttgctcacttcggcggccacgttgatctctg	Protospacer
.    .******* ******** ********* .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 697321 : 708832 11 Leptospira_phage(50.0%) transposase NA
DBSCAN-SWA_2 1182651 : 1315596 112 Bacillus_phage(21.74%) integrase,holin,protease,transposase attL 1225590:1225611|attR 1269376:1270576
DBSCAN-SWA_3 1991887 : 2002658 7 Micromonas_pusilla_virus(16.67%) tRNA NA
DBSCAN-SWA_4 2078065 : 2087820 7 Leptospira_phage(80.0%) transposase,integrase attL 2078037:2078096|attR 2109959:2111184
DBSCAN-SWA_5 2595021 : 2633892 32 Salmonella_phage(40.0%) transposase,integrase attL 2600528:2600544|attR 2637363:2637379
DBSCAN-SWA_6 2651515 : 2683544 27 Escherichia_phage(40.0%) transposase,integrase attL 2671585:2671644|attR 2683539:2684419
DBSCAN-SWA_7 2767962 : 2799187 41 Xanthomonas_phage(66.67%) transposase,coat,integrase attL 2753759:2753773|attR 2805815:2805829
DBSCAN-SWA_8 3849081 : 3885240 30 Leptospira_phage(50.0%) transposase NA
DBSCAN-SWA_9 4277703 : 4285748 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_10 4789112 : 4869041 58 Ralstonia_phage(25.0%) transposase,protease,plate NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage