Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 0 crisprs csa3,DEDDh 0 0 1 0
NC_008380 Rhizobium leguminosarum bv. viciae 3841, complete genome 4 crisprs WYL,cas3,csa3,DEDDh 0 4 7 0
NC_008383 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL8, complete sequence 0 crisprs NA 0 0 0 0
NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 0 crisprs NA 0 0 2 0
NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 0 crisprs NA 0 0 0 0
NC_008378 Rhizobium leguminosarum bv. viciae 3841, complete genome 0 crisprs csa3 0 0 0 0
NC_008382 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL7, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_008381
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5130 : 56093 37 Acidianus_tailed_spindle_virus(25.0%) integrase,transposase NA
DBSCAN-SWA_2 90822 : 168191 55 Staphylococcus_phage(21.43%) integrase,transposase attL 150634:150693|attR 168486:170028
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_008384
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 372504 : 384122 13 Leptospira_phage(33.33%) transposase,integrase attL 367326:367340|attR 382618:382632
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_008380
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008380_1 1053886-1053968 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008380_2 1148547-1148845 Orphan NA
5 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008380_3 2416760-2416839 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008380_4 2690763-2690905 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP018230 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence 151128-151159 2 0.938
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1243333-1243364 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP032685 Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence 820851-820882 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050093 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence 248454-248485 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050105 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence 550469-550500 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP032690 Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence 820399-820430 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 399777-399808 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 449537-449568 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 27029-27060 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP025508 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence 459736-459767 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050110 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence 550471-550502 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP048282 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence 261038-261069 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 1079588-1079619 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP022667 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence 177837-177868 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 676724-676755 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050087 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence 458520-458551 3 0.906
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_008384 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence 221099-221130 4 0.875
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 142455-142486 4 0.875
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 573967-573998 4 0.875
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 515419-515450 4 0.875
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP054023 Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence 7460-7491 4 0.875
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP054033 Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence 161093-161124 4 0.875
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 NZ_CP045548 Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence 491707-491734 5 0.821
NC_008380_2 2.3|1148672|28|NC_008380|CRT 1148672-1148699 28 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1243370-1243397 5 0.821
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 495288-495315 5 0.821
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 330268-330299 5 0.844
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 540159-540190 5 0.844
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 62081-62108 6 0.786
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 NC_031265 Gordonia phage Guacamole, complete genome 32615-32642 6 0.786
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 MK501729 Gordonia phage Walrus, complete genome 32394-32421 6 0.786
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 MK967389 Gordonia phage JasperJr, complete genome 32615-32642 6 0.786
NC_008380_2 2.1|1148567|28|NC_008380|CRT 1148567-1148594 28 MT723936 Gordonia phage Hitter, complete genome 32259-32286 6 0.786
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 NZ_CP044976 Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence 222527-222554 6 0.786
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 1267353-1267380 6 0.786
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 52908-52935 6 0.786
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1114160-1114191 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1180383-1180414 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 629269-629300 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1114166-1114197 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 322620-322651 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 73125-73156 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1142094-1142125 6 0.812
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 1043349-1043380 6 0.812
NC_008380_2 2.3|1148672|28|NC_008380|CRT 1148672-1148699 28 NC_006525 Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence 25291-25318 7 0.75
NC_008380_2 2.3|1148672|28|NC_008380|CRT 1148672-1148699 28 MK279853 Gordonia phage Gray, complete genome 67177-67204 7 0.75
NC_008380_2 2.3|1148672|28|NC_008380|CRT 1148672-1148699 28 MN586022 Gordonia phage Chidiebere, complete genome 67246-67273 7 0.75
NC_008380_2 2.3|1148672|28|NC_008380|CRT 1148672-1148699 28 NZ_CP046330 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence 81401-81428 7 0.75
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 MH697592 Mycobacterium phage Rando14, complete genome 165-192 7 0.75
NC_008380_2 2.5|1148798|28|NC_008380|CRT 1148798-1148825 28 NZ_CP024609 Massilia violaceinigra strain B2 plasmid unnamed, complete sequence 31303-31330 7 0.75
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 334178-334209 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 306596-306627 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 374134-374165 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 1674430-1674461 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1327700-1327731 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1428587-1428618 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 516320-516351 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 303860-303891 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 306597-306628 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP050082 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence 490406-490437 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP049732 Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence 424675-424706 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 990529-990560 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1384485-1384516 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1416770-1416801 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1559573-1559604 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 16955-16986 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 540667-540698 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1438899-1438930 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 309373-309404 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1725-1756 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1261455-1261486 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1399664-1399695 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 96051-96082 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1208726-1208757 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 30809-30840 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 29720-29751 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1593384-1593415 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP053208 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence 388891-388922 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1193573-1193604 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1545576-1545607 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 628818-628849 7 0.781
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_CP015232 Epibacterium mobile F1926 plasmid unnamed2, complete sequence 132158-132189 8 0.75
NC_008380_3 3.1|2416784|32|NC_008380|CRISPRCasFinder 2416784-2416815 32 NZ_LR027555 Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence 70325-70356 8 0.75

1. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttacgtccggaattgcgcagaaacaaa	Protospacer
******* ***********************.

2. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaattgcgcagaaacata	Protospacer
*******.********************** .

3. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaattgcgtagaaacaaa	Protospacer
*******.**************.********.

4. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttgcgtccggaattgcgcggaaacaaa	Protospacer
******* ***************.*******.

5. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

6. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaattgcgtagaaacaaa	Protospacer
*******.**************.********.

7. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttgcgtccggaattgcgcggaaacaaa	Protospacer
******* ***************.*******.

8. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

9. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttgcgtccggaattgcggagaaacaaa	Protospacer
******* ************** ********.

10. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

11. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

12. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cgattttacgtccggaattgcgcagaaacaaa	Protospacer
**.**** ***********************.

13. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

14. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

15. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

16. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 3, identity: 0.906

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
**********************.*.******.

17. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
tggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
.*********************.*.******.

18. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
tggtttttcgtccggaattgcgtaaaaacaaa	Protospacer
.*********************.*.******.

19. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacgaa	Protospacer
**********************.*.****.*.

20. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaaacgaa	Protospacer
**********************.*.****.*.

21. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttgcgtccggaattgcgcggaaaccaa	Protospacer
******* ***************.***** *.

22. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 4, identity: 0.875

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttgcgtccggaattgcgcggaaaccaa	Protospacer
******* ***************.***** *.

23. spacer 2.1|1148567|28|NC_008380|CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
tcttcgcgaagtgcccccaccggctggc	Protospacer
 ** * ******************.*.*

24. spacer 2.3|1148672|28|NC_008380|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.821

gctgctggaggtgccgccaccggctgat	CRISPR spacer
gctgctggaggcgccgccaccgccgcag	Protospacer
***********.********** *  * 

25. spacer 2.5|1148798|28|NC_008380|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.821

gctgctcgcagttccgccgccggccgac	CRISPR spacer
ccggcccgcagttccgccgccggctggc	Protospacer
 * **.******************.*.*

26. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 5, identity: 0.844

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcacaaaacaagg	Protospacer
*********************.**.**  *.*

27. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggtttttcgtccggaattgcgtaaaacaaaa	Protospacer
**********************.*.**  **.

28. spacer 2.1|1148567|28|NC_008380|CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 6, identity: 0.786

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
cggtctcgaagtgccaccaccggccgcc	Protospacer
    *********** ********** *

29. spacer 2.1|1148567|28|NC_008380|CRT matches to NC_031265 (Gordonia phage Guacamole, complete genome) position: , mismatch: 6, identity: 0.786

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
ggggctcgaagtgcccccacccggcgtg	Protospacer
*  ****************** * **  

30. spacer 2.1|1148567|28|NC_008380|CRT matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 6, identity: 0.786

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
ggggctcgaagtgcccccacccggcgtg	Protospacer
*  ****************** * **  

31. spacer 2.1|1148567|28|NC_008380|CRT matches to MK967389 (Gordonia phage JasperJr, complete genome) position: , mismatch: 6, identity: 0.786

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
ggggctcgaagtgcccccacccggcgtg	Protospacer
*  ****************** * **  

32. spacer 2.1|1148567|28|NC_008380|CRT matches to MT723936 (Gordonia phage Hitter, complete genome) position: , mismatch: 6, identity: 0.786

gctgctcgaagtgcccccaccggccgac	CRISPR spacer
ggggctcgaagtgcccccacccggcgtg	Protospacer
*  ****************** * **  

33. spacer 2.5|1148798|28|NC_008380|CRT matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 6, identity: 0.786

gctgctcgcagttccgccgccggccgac	CRISPR spacer
gctgctcgcagttccggcgcctggccct	Protospacer
**************** **** * *  .

34. spacer 2.5|1148798|28|NC_008380|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.786

gctgctcgcagttccgccgccggccgac	CRISPR spacer
tcggctggcaggtccgccgccggccgga	Protospacer
 * *** **** **************. 

35. spacer 2.5|1148798|28|NC_008380|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 6, identity: 0.786

gctgctcgcagttccgccgccggccgac	CRISPR spacer
tcggctggcaggtccgccgccggccgga	Protospacer
 * *** **** **************. 

36. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagcgtcaaa	Protospacer
*******.********* ******* . ***.

37. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagcgtcaaa	Protospacer
*******.********* ******* . ***.

38. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagcgtcaaa	Protospacer
*******.********* ******* . ***.

39. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagcgtcaaa	Protospacer
*******.********* ******* . ***.

40. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gcggttttcgtccggaattgcgtaaaaacaaa	Protospacer
  * ******************.*.******.

41. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagtttcaaa	Protospacer
*******.********* *******   ***.

42. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cagttttgcgtccggaattgcgcaaaagctaa	Protospacer
*.***** ****************.**.* *.

43. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 6, identity: 0.812

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcagtttcaaa	Protospacer
*******.********* *******   ***.

44. spacer 2.3|1148672|28|NC_008380|CRT matches to NC_006525 (Cupriavidus metallidurans CH34 plasmid pMOL28, complete sequence) position: , mismatch: 7, identity: 0.75

gctgctggaggtgccgccaccggctgat	CRISPR spacer
gctgctggcggtgccgcgaccggagacg	Protospacer
******** ******** *****  .  

45. spacer 2.3|1148672|28|NC_008380|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 7, identity: 0.75

gctgctggaggtgccgccaccggctgat	CRISPR spacer
gctgctggtggtgccaccaccggtacgc	Protospacer
******** ******.*******.  ..

46. spacer 2.3|1148672|28|NC_008380|CRT matches to MN586022 (Gordonia phage Chidiebere, complete genome) position: , mismatch: 7, identity: 0.75

gctgctggaggtgccgccaccggctgat	CRISPR spacer
gctgctggtggtgccaccaccggtacgc	Protospacer
******** ******.*******.  ..

47. spacer 2.3|1148672|28|NC_008380|CRT matches to NZ_CP046330 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

gctgctggaggtgccgccaccggctgat	CRISPR spacer
gctgctggcggtgccgcgaccggagacg	Protospacer
******** ******** *****  .  

48. spacer 2.5|1148798|28|NC_008380|CRT matches to MH697592 (Mycobacterium phage Rando14, complete genome) position: , mismatch: 7, identity: 0.75

gctgctcgcagttccgccgccggccgac	CRISPR spacer
tcgagtcgcagttccgacgccggccgtt	Protospacer
 * . *********** ********* .

49. spacer 2.5|1148798|28|NC_008380|CRT matches to NZ_CP024609 (Massilia violaceinigra strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75

gctgctcgcagttccgccgccggccgac	CRISPR spacer
caggctcgcgattccgccgccggccgcg	Protospacer
   ******..***************  

50. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gcggttcgcgtccggaattgcgcggaaacaaa	Protospacer
  * **. ***************.*******.

51. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

52. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

53. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

54. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcgatttcaag	Protospacer
*******.********* *****..   ****

55. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

56. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

57. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

58. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

59. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gggttttgcgtccggaattgcgtagagcaaac	Protospacer
 ****** **************.***.  ** 

60. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gggttttgcgtccggaattgcgtagagcaaac	Protospacer
 ****** **************.***.  ** 

61. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

62. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

63. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

64. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

65. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

66. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

67. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

68. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

69. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

70. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

71. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

72. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

73. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgccatttcaag	Protospacer
*******.********* ***** .   ****

74. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgttcggaattgcgcagcgcaaaa	Protospacer
*******.***.************* .  **.

75. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgttcggaattgcgcagcgcaaaa	Protospacer
*******.***.************* .  **.

76. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaagtgcgcgatttcaag	Protospacer
*******.********* *****..   ****

77. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gggttttgcgtccggaattgcgtagagcaaac	Protospacer
 ****** **************.***.  ** 

78. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
gggttttccgtccggaattgcggagtttcaaa	Protospacer
 ******.************** **   ***.

79. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaattgtgctcagaaaat	Protospacer
*******.************.**  *.* ** 

80. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.781

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttttccgtccggaattgtgctcagaaaat	Protospacer
*******.************.**  *.* ** 

81. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttctgcgtccggaattgcgcggtcagatc	Protospacer
*****.* ***************.*  * *  

82. spacer 3.1|2416784|32|NC_008380|CRISPRCasFinder matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75

cggtttttcgtccggaattgcgcagaaacaag	CRISPR spacer
cggttctgcgtccggaattgcgcggtcagatc	Protospacer
*****.* ***************.*  * *  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1693674 : 1702942 9 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_2 1766445 : 1777277 7 Bacillus_phage(16.67%) protease NA
DBSCAN-SWA_3 2157012 : 2170512 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_4 2524790 : 2535308 10 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_5 3568479 : 3582013 10 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_6 4167928 : 4180509 21 Sinorhizobium_phage(25.0%) NA NA
DBSCAN-SWA_7 4511298 : 4521429 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_008382
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 23646 : 68739 33 Escherichia_phage(27.27%) transposase,integrase attL 12825:12842|attR 68329:68346
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage