1. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcgaagccggcggcagcg Protospacer
*******.**************
3. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
4. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
5. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
6. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
7. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
8. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
9. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
10. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcgcagccggcggcagcg Protospacer
******* **************
11. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
12. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
13. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
14. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
15. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
16. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
17. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
18. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
19. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
20. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
21. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
22. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
23. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KP087941 (Eel River basin pequenovirus isolate c10494, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagccggcggctgcg Protospacer
****************** ***
24. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
25. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
26. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
27. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
28. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
29. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
30. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
31. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
32. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
33. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
34. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
35. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
36. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
37. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
38. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
39. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
40. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
41. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
42. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
43. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
44. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
45. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
46. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
47. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
48. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
49. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
50. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
51. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
52. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
53. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
54. spacer 4.19|957909|27|NC_008769|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
55. spacer 4.19|957909|27|NC_008769|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
56. spacer 4.19|957909|27|NC_008769|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
57. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
58. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
59. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
60. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
61. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
62. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
63. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
64. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
65. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
66. spacer 5.15|1244016|22|NC_008769|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
67. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
68. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
69. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
70. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
71. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
72. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
73. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
74. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcggcg Protospacer
.*****************.***
75. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagccggcggcggct Protospacer
******************.**
76. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
77. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
78. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
79. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
80. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
81. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
82. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
83. spacer 1.11|362248|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
84. spacer 1.11|362248|27|NC_008769|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
85. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
86. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
87. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
88. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
89. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
90. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
91. spacer 4.18|957867|24|NC_008769|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
92. spacer 4.18|957867|24|NC_008769|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
93. spacer 4.18|957867|24|NC_008769|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
94. spacer 4.18|957867|24|NC_008769|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
95. spacer 4.18|957867|24|NC_008769|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
96. spacer 4.18|957867|24|NC_008769|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
97. spacer 4.18|957867|24|NC_008769|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
98. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
99. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
100. spacer 4.18|957867|24|NC_008769|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
101. spacer 4.19|957909|27|NC_008769|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgg Protospacer
**************** ********
102. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcggcaacggcta Protospacer
******************.****** .
103. spacer 4.19|957909|27|NC_008769|CRT matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 3, identity: 0.889
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgctgg-cggcaaaggcggtaacggcgg Protospacer
****. ****** **************
104. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
105. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
106. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
107. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
108. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
109. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
110. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
111. spacer 5.7|1243632|22|NC_008769|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
112. spacer 5.11|1243815|22|NC_008769|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
113. spacer 6.5|2089454|24|NC_008769|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
114. spacer 6.5|2089454|24|NC_008769|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
115. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP013072 (Sphingobium indicum B90A plasmid pSRL2, complete sequence) position: , mismatch: 3, identity: 0.885
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ttcgcccaccggcaccggcaccggcg Protospacer
. ************ ***********
116. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP022192 (Yangia pacifica strain YSBP01 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.885
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcgcccaccgggagccgcaccggca Protospacer
************ *** ********.
117. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgcccgccggcagccgcaccggcg Protospacer
* *****.******** *********
118. spacer 10.9|3928892|26|NC_008769|CRT matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 3, identity: 0.885
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgcccaccgtccgcggcaccggcg Protospacer
* ********* * ************
119. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.885
cgcgcccaccggcagcggc--accggcg CRISPR spacer
cgcgcccaccggcagcggcctgccgg-- Protospacer
******************* .****
120. spacer 11.1|4067153|22|NC_008769|CRISPRCasFinder matches to MN857473 (Teseptimavirus S2B, complete genome) position: , mismatch: 3, identity: 0.864
gccggcggagccggcggcagcg CRISPR spacer
cgaggcggagccggcggcagcg Protospacer
*******************
121. spacer 4.12|957582|27|NC_008769|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
122. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
123. spacer 4.12|957582|27|NC_008769|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
124. spacer 4.17|957819|30|NC_008769|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
125. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
126. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
127. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
128. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
129. spacer 4.18|957867|24|NC_008769|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
130. spacer 4.18|957867|24|NC_008769|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
131. spacer 4.18|957867|24|NC_008769|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
132. spacer 4.18|957867|24|NC_008769|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
133. spacer 4.18|957867|24|NC_008769|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
134. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
135. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
136. spacer 4.18|957867|24|NC_008769|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
137. spacer 4.18|957867|24|NC_008769|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
138. spacer 4.18|957867|24|NC_008769|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
139. spacer 4.18|957867|24|NC_008769|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
140. spacer 4.19|957909|27|NC_008769|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgg Protospacer
* .**********************
141. spacer 4.19|957909|27|NC_008769|CRT matches to MG198783 (Gordonia phage Mahdia, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccagaccggcaacggcggtaacggcgt Protospacer
* **.********************
142. spacer 4.19|957909|27|NC_008769|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggccgg--ggcaacggcggtaacggcgg Protospacer
**.*. ********************
143. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggtgatcgtcaacggcggcaacggcga Protospacer
* ****** *********.*******.
144. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgctcggccacggcggtaacggctg Protospacer
*** ***** ************** *
145. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
146. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
147. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgggaacaaccg Protospacer
****************** ***..* *
148. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
tagcgg--cggcaacggcggtagcggcgg Protospacer
** * **************.******
149. spacer 4.19|957909|27|NC_008769|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
150. spacer 4.19|957909|27|NC_008769|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
151. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
152. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
153. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
154. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
155. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
156. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
157. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
158. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
159. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
160. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
161. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
162. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
163. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
164. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
165. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
166. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
167. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
168. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
169. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
170. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
171. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
172. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
173. spacer 6.5|2089454|24|NC_008769|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
174. spacer 6.5|2089454|24|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
175. spacer 6.5|2089454|24|NC_008769|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
176. spacer 10.3|3928457|26|NC_008769|CRT matches to JX403939 (Pseudomonas phage YMC/01/01/P52_PAE_BP, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcagcggtgccggcggcaccaatt Protospacer
..**********************.
177. spacer 10.3|3928457|26|NC_008769|CRT matches to KU310943 (Pseudomonas phage YMC11/07/P54_PAE_BP, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcagcggtgccggcggcaccaatt Protospacer
..**********************.
178. spacer 10.3|3928457|26|NC_008769|CRT matches to NC_042342 (Pseudomonas virus H66, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcagcggtgccggcggcaccagct Protospacer
..*********************.*
179. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP054842 (Acidovorax sp. 16-35-5 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
ccgcatcggtgccggcggcaccatcg Protospacer
. *** ***************** **
180. spacer 10.3|3928457|26|NC_008769|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
tggcagcggtgccggcggcaccctct Protospacer
*.******************** *
181. spacer 10.3|3928457|26|NC_008769|CRT matches to MN369748 (Mycobacterium phage Miko, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcggcggtgccggcggcaacaacg Protospacer
..**.*************** *****
182. spacer 10.3|3928457|26|NC_008769|CRT matches to MF185727 (Mycobacterium phage BobSwaget, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcggcggtgccggcggcaacaacg Protospacer
..**.*************** *****
183. spacer 10.3|3928457|26|NC_008769|CRT matches to MK801735 (Mycobacterium Phage Rachaly, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcggcggtgccggcggcaacaacg Protospacer
..**.*************** *****
184. spacer 10.3|3928457|26|NC_008769|CRT matches to MF324899 (Mycobacterium phage Lokk, complete genome) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcggcggtgccggcggcaacaacg Protospacer
..**.*************** *****
185. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
tagcagcggtgccggcggcaccaacg CRISPR spacer
gatcatcggtgccggcggcaccatcg Protospacer
* ** ***************** **
186. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
gtcctccaccggcagcggcaccggcg Protospacer
* .*********************
187. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
gtcctccaccggcagcggcaccggcg Protospacer
* .*********************
188. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggataccaccggcagcggcaccggcg Protospacer
* *********************
189. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcgcccaacggcagccgcaccggga Protospacer
******** ******* ******* .
190. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP020813 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cggtgtcaccggcagcggcaccggcg Protospacer
** .********************
191. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_017536 (Oligotropha carboxidovorans OM4 plasmid pHCG3B, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggctgccaccggcagcgtcaccggcg Protospacer
** ************ ********
192. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP010057 (Hymenobacter sp. DG25B plasmid, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgc-ccaccggcagcggcaccggcg CRISPR spacer
-atgcaccaccgccagcggcaccggcg Protospacer
..** ****** **************
193. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcccccaccggcagcggcacaaccg Protospacer
*** ***************** . **
194. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_015689 (Oligotropha carboxidovorans OM5 plasmid pHCG3, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggctgccaccggcagcgtcaccggcg Protospacer
** ************ ********
195. spacer 10.9|3928892|26|NC_008769|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcccacaccggcagcggcaccgcca Protospacer
*** * ***************** *.
196. spacer 10.9|3928892|26|NC_008769|CRT matches to MH617654 (Caudovirales sp. isolate ctbf53, complete genome) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcgcccaccgccagcgccaccgcct Protospacer
*********** ***** ***** *
197. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctccgccaccggcaacggcaccggcg Protospacer
* * *********.***********
198. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcgcgcaccggcagcggcacgttcg Protospacer
***** *************** **
199. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
caagcacaccggcagcggcaccgccg Protospacer
*. ** ***************** **
200. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP010864 (Marinovum algicola DG 898 plasmid pMaD9, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ccgggccaccagcagcggcaccggcg Protospacer
* * *****.***************
201. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_023006 (Pseudomonas phage PPpW-3 DNA, complete sequence) position: , mismatch: 4, identity: 0.846
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgtcaccaccggcagcggcaccagcg Protospacer
**. *****************.***
202. spacer 1.2|361768|27|NC_008769|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
203. spacer 1.11|362248|27|NC_008769|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
204. spacer 1.11|362248|27|NC_008769|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
205. spacer 1.11|362248|27|NC_008769|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
206. spacer 1.12|362293|30|NC_008769|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
207. spacer 1.12|362293|30|NC_008769|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
208. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
209. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
210. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
211. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
212. spacer 4.5|957288|27|NC_008769|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
213. spacer 4.5|957288|27|NC_008769|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
214. spacer 4.5|957288|27|NC_008769|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
215. spacer 4.5|957288|27|NC_008769|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
216. spacer 4.5|957288|27|NC_008769|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
217. spacer 4.8|957423|30|NC_008769|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcccggg Protospacer
******** * ************* ***
218. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcacggg Protospacer
******** * ************* . ***
219. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
220. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
221. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
222. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
223. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
224. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
225. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
226. spacer 4.12|957582|27|NC_008769|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
227. spacer 4.12|957582|27|NC_008769|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
228. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
229. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
230. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
231. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
232. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
233. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
234. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
235. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
236. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
237. spacer 4.17|957819|30|NC_008769|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
238. spacer 4.18|957867|24|NC_008769|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
239. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggtaacgccgg Protospacer
.*.*. ***************** ***
240. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gttcttcggcaacggcggcaacggcgc Protospacer
*.* *************.*******
241. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
242. spacer 4.19|957909|27|NC_008769|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgacaacggttt Protospacer
*****************..*****.
243. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
244. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
245. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
246. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
247. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
248. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
249. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
250. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
251. spacer 4.19|957909|27|NC_008769|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815
gctgat--cggcaacggcggtaacggcgg CRISPR spacer
--cgacggcggcaatggcggtaacggcgg Protospacer
.**. ******.**************
252. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgaacggcaacggcggcaacgacac Protospacer
***** ************.****.*.
253. spacer 4.19|957909|27|NC_008769|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
254. spacer 4.19|957909|27|NC_008769|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
255. spacer 4.19|957909|27|NC_008769|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
256. spacer 4.19|957909|27|NC_008769|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
257. spacer 4.19|957909|27|NC_008769|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
258. spacer 4.19|957909|27|NC_008769|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
259. spacer 4.19|957909|27|NC_008769|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
260. spacer 4.19|957909|27|NC_008769|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
261. spacer 4.19|957909|27|NC_008769|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
262. spacer 4.19|957909|27|NC_008769|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
263. spacer 4.19|957909|27|NC_008769|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
264. spacer 4.19|957909|27|NC_008769|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
265. spacer 4.19|957909|27|NC_008769|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
266. spacer 4.19|957909|27|NC_008769|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
267. spacer 4.19|957909|27|NC_008769|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
268. spacer 4.19|957909|27|NC_008769|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
269. spacer 4.19|957909|27|NC_008769|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
270. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
271. spacer 4.19|957909|27|NC_008769|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggtggcaacgactt Protospacer
***************.**.****.*
272. spacer 4.19|957909|27|NC_008769|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
273. spacer 4.19|957909|27|NC_008769|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
274. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
275. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggccacggcggcaacgacat Protospacer
********** *******.****.*.
276. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
277. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
278. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
279. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
280. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
281. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
282. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
283. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
284. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
285. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
286. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
287. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
288. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
289. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
290. spacer 4.19|957909|27|NC_008769|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
291. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
292. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
293. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
294. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
295. spacer 5.4|1243452|25|NC_008769|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
296. spacer 10.3|3928457|26|NC_008769|CRT matches to NC_006552 (Pseudomonas phage F116, complete genome) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
gggcagcggtgccggcggcaccagtt Protospacer
.*********************..
297. spacer 10.3|3928457|26|NC_008769|CRT matches to KC900378 (Pseudomonas phage LKA5, complete genome) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
gggcagcggtgccggcggcaccagtt Protospacer
.*********************..
298. spacer 10.3|3928457|26|NC_008769|CRT matches to AY625898 (Pseudomonas aeruginosa phage F116, complete genome) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
gggcagcggtgccggcggcaccagtt Protospacer
.*********************..
299. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
cctcagcggtgccggcagcaccaaca Protospacer
. *************.********.
300. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
aggcagcggtcccggcggcaccatca Protospacer
.******** ************ *.
301. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
302. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
303. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
cagcagcggcgccggcggcaccgggg Protospacer
.********.************.. *
304. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
305. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
306. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
307. spacer 10.3|3928457|26|NC_008769|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
gatcagcggtgccggcggcaccttct Protospacer
* ******************* *
308. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
309. spacer 10.3|3928457|26|NC_008769|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
310. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
311. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
312. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
313. spacer 10.3|3928457|26|NC_008769|CRT matches to MF975720 (Pseudomonas phage VW-6S, complete genome) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ccgccgcggcgccggcggcaccaact Protospacer
. ** ****.***************
314. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
315. spacer 10.3|3928457|26|NC_008769|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
316. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
317. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
318. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
319. spacer 10.3|3928457|26|NC_008769|CRT matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
gtacagcggcgccggcggcaccaagg Protospacer
.******.************** *
320. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
321. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
322. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
323. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
324. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
325. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
326. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
327. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
328. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
329. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
330. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
331. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
332. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
333. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
334. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
335. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
336. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
337. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
338. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
339. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
340. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
341. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
342. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
343. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
344. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
345. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
346. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
347. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
348. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
349. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
350. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
351. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
352. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
353. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
354. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
355. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
356. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
357. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
358. spacer 10.3|3928457|26|NC_008769|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
359. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
360. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
361. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
362. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
363. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
364. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
365. spacer 10.3|3928457|26|NC_008769|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.808
tagcagcggtgccggcggcaccaacg CRISPR spacer
ggtcagcgatgccggcggcatcaacg Protospacer
. *****.***********.*****
366. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggcgtccaccggcaccggcaccggac Protospacer
***.********* *********
367. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggcgtccaccggcaccggcaccggac Protospacer
***.********* *********
368. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP035420 (Leisingera sp. NJS204 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
atagcggaccggcagcggcaccggcg Protospacer
** *******************
369. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
atggccgaccggcagcagcaccggcg Protospacer
*** *********.*********
370. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgccctccggcagcggcaccgcgc Protospacer
* ***** ***************
371. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP028567 (Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid pMCR5_045096, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
atcgtccaccggcaccggcaccggca Protospacer
**.********* **********.
372. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctatcccaccggcggcggcaccggcc Protospacer
* *********.***********
373. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
aacccccaccggcaccggcaccggca Protospacer
.* ********** **********.
374. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
gtcgcccaccggcaccgccaccggcc Protospacer
************ ** *******
375. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
cgcgcccaccgacaccggcaccgcat Protospacer
***********.** ********
376. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
aggatccaccggcggcggcaccggcg Protospacer
* ..********.************
377. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgccctccggcagcggcaccgcgc Protospacer
* ***** ***************
378. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgccctccggcagcggcaccgcgc Protospacer
* ***** ***************
379. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
gatgcccagcggcagcggcacgggcg Protospacer
..***** ************ ****
380. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
aacccccaccggcaccggcaccggca Protospacer
.* ********** **********.
381. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
aacccccaccggcaccggcaccggca Protospacer
.* ********** **********.
382. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggcgcccaccggcagccggaccgggc Protospacer
*************** * *****
383. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgccctccggcagcggcaccgcgc Protospacer
* ***** ***************
384. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ggcgcgcaccggcagcggcacctgga Protospacer
**** **************** * .
385. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ctcgccctccggcagcggcaccgcgc Protospacer
* ***** ***************
386. spacer 10.9|3928892|26|NC_008769|CRT matches to MH509442 (Mycobacterium phage Aminay, complete genome) position: , mismatch: 5, identity: 0.808
cgcgcccaccggcagcggcaccggcg CRISPR spacer
tgacgccaccggcagccgcaccggcg Protospacer
.* *********** *********
387. spacer 1.3|361813|30|NC_008769|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
388. spacer 1.12|362293|30|NC_008769|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
389. spacer 1.12|362293|30|NC_008769|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
390. spacer 1.12|362293|30|NC_008769|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
391. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
392. spacer 4.5|957288|27|NC_008769|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
393. spacer 4.5|957288|27|NC_008769|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
394. spacer 4.5|957288|27|NC_008769|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
395. spacer 4.5|957288|27|NC_008769|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
396. spacer 4.5|957288|27|NC_008769|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
397. spacer 4.5|957288|27|NC_008769|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
398. spacer 4.5|957288|27|NC_008769|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
399. spacer 4.5|957288|27|NC_008769|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
400. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
401. spacer 4.8|957423|30|NC_008769|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
402. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
403. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
404. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
405. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
406. spacer 4.8|957423|30|NC_008769|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
407. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
408. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
409. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
410. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
411. spacer 4.8|957423|30|NC_008769|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
412. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
413. spacer 4.8|957423|30|NC_008769|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
414. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
415. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
416. spacer 4.12|957582|27|NC_008769|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
417. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
418. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
419. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
420. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
421. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
422. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
423. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
424. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
425. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
426. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
427. spacer 4.15|957723|30|NC_008769|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
428. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
429. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
430. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
431. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
432. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
433. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
434. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
435. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
436. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
437. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
438. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
439. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
440. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
441. spacer 4.15|957723|30|NC_008769|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
442. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
443. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
444. spacer 4.17|957819|30|NC_008769|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
445. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
446. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
447. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
448. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
449. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
450. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
451. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
452. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
453. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
454. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
455. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
456. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
457. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
458. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
459. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
460. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
461. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
462. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
463. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
464. spacer 4.17|957819|30|NC_008769|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
465. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
aacgggcggcaacggcggcaacggcgg Protospacer
. .*. ************.********
466. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccccggcggcaacggcggcaacggcgg Protospacer
*. . ************.********
467. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
acgcggcggcgacggcggtaacggcgg Protospacer
.* . ****.****************
468. spacer 4.19|957909|27|NC_008769|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgaaagcggcaacggcggtaacggcga Protospacer
.* ********************.
469. spacer 4.19|957909|27|NC_008769|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccacgctggcaacggcggtaacggcgg Protospacer
* ...********************
470. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcgg Protospacer
* . . ************ ********
471. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
472. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggcaacggcgg Protospacer
* . ************.********
473. spacer 4.19|957909|27|NC_008769|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggccggcggcagcggcggtaacggcgg Protospacer
* . . *****.***************
474. spacer 4.19|957909|27|NC_008769|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggacgccggcaacggcggcaacggcgg Protospacer
* ..************.********
475. spacer 4.19|957909|27|NC_008769|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccatcggcaacggcggtagcggtgg Protospacer
. ****************.***.**
476. spacer 4.19|957909|27|NC_008769|CRT matches to KR997929 (Mycobacterium phage Barriga, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
477. spacer 4.19|957909|27|NC_008769|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
478. spacer 4.19|957909|27|NC_008769|CRT matches to NC_028815 (Mycobacterium phage Nhonho, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
479. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggtaccggcgg Protospacer
* . ************** ******
480. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
481. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatcggcaacggcggttgcggcgg Protospacer
*************** .******
482. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
483. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
484. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
485. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
486. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
487. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
488. spacer 10.3|3928457|26|NC_008769|CRT matches to KM389247 (UNVERIFIED: Pseudomonas phage JBD90 clone contig00001 genomic sequence) position: , mismatch: 6, identity: 0.769
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcagaggtgccggcggcaccagtt Protospacer
..**** ****************..
489. spacer 10.3|3928457|26|NC_008769|CRT matches to LT603684 (Pseudomonas phage phiC725A genome assembly) position: , mismatch: 6, identity: 0.769
tagcagcggtgccggcggcaccaacg CRISPR spacer
cggcagaggtgccggcggcaccagtt Protospacer
..**** ****************..
490. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.829
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
caacggcggggccggcggtagcggcggcgcaggcg Protospacer
**.************************ ** ..*
491. spacer 10.9|3928892|26|NC_008769|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.769
cgcgcccaccggcagcggcaccggcg CRISPR spacer
gctccccaccggcagcggcacctgca Protospacer
. ****************** **.
492. spacer 10.9|3928892|26|NC_008769|CRT matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 6, identity: 0.769
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ccaacccaccggcagcggcaccgcgc Protospacer
* .*******************
493. spacer 10.9|3928892|26|NC_008769|CRT matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 6, identity: 0.769
cgcgcccaccggcagcggcaccggcg CRISPR spacer
ccaacccaccggcagcggcaccgcgc Protospacer
* .*******************
494. spacer 11.2|4067200|36|NC_008769|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac Protospacer
*** *******************.**** .** **
495. spacer 11.2|4067200|36|NC_008769|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.833
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac Protospacer
*** *******************.**** .** **
496. spacer 1.3|361813|30|NC_008769|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
497. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
498. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
499. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
500. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
501. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
502. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
503. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
504. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
505. spacer 1.12|362293|30|NC_008769|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
506. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
507. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
508. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
509. spacer 1.12|362293|30|NC_008769|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
510. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
511. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
512. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
513. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
514. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
515. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
516. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
517. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
518. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
519. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
520. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
521. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
522. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
523. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
524. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
525. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
526. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
527. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
528. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
cccgctgggcggattccgcgtcggggaagg Protospacer
* ..* ************* ******.**
529. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
gggattcggtggattcagcggcggtggtgc Protospacer
********.****** ******* *. *
530. spacer 4.15|957723|30|NC_008769|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
531. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
532. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
533. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
534. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
535. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
536. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
537. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
538. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
539. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
540. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
541. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
542. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
543. spacer 4.15|957723|30|NC_008769|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
544. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
545. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
546. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
547. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
548. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
549. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
550. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
551. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
552. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
553. spacer 4.15|957723|30|NC_008769|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
554. spacer 4.15|957723|30|NC_008769|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
555. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
556. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
557. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
558. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
559. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
560. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
561. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
562. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
563. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
564. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
565. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
566. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
567. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
568. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
569. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
570. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
571. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
572. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
573. spacer 4.15|957723|30|NC_008769|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
574. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
575. spacer 4.15|957723|30|NC_008769|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
576. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
577. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
578. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
579. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
580. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
581. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
582. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
583. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
584. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
585. spacer 4.15|957723|30|NC_008769|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
586. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
587. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
588. spacer 4.15|957723|30|NC_008769|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
589. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
590. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
591. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
592. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
593. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
594. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
595. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
596. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
597. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
598. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
599. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
600. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
601. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
602. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
603. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
604. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
605. spacer 4.15|957723|30|NC_008769|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
606. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
607. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
608. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
609. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
610. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
611. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
612. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
613. spacer 4.15|957723|30|NC_008769|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
614. spacer 4.15|957723|30|NC_008769|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
615. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
616. spacer 4.15|957723|30|NC_008769|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
617. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
618. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
619. spacer 4.15|957723|30|NC_008769|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
620. spacer 4.15|957723|30|NC_008769|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
621. spacer 4.15|957723|30|NC_008769|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
622. spacer 4.15|957723|30|NC_008769|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
623. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
624. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
625. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
626. spacer 4.17|957819|30|NC_008769|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
627. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
628. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
629. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
630. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
631. spacer 4.17|957819|30|NC_008769|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
632. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
633. spacer 4.17|957819|30|NC_008769|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
634. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
635. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
636. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
637. spacer 4.17|957819|30|NC_008769|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
638. spacer 4.17|957819|30|NC_008769|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
639. spacer 4.17|957819|30|NC_008769|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
640. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
641. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
642. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
643. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
644. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
645. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgcaggcggcaacggcggtagcggcgg Protospacer
... **************.******
646. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
647. spacer 4.19|957909|27|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
648. spacer 4.19|957909|27|NC_008769|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
atctggaggcaacggcggtaacggcgg Protospacer
... . ********************
649. spacer 4.19|957909|27|NC_008769|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
650. spacer 4.19|957909|27|NC_008769|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
651. spacer 4.19|957909|27|NC_008769|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
652. spacer 4.19|957909|27|NC_008769|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
653. spacer 4.19|957909|27|NC_008769|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctcgatcagcaacggcggtaacggttt Protospacer
..****.****************.
654. spacer 4.19|957909|27|NC_008769|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
655. spacer 4.19|957909|27|NC_008769|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
656. spacer 4.19|957909|27|NC_008769|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
657. spacer 4.19|957909|27|NC_008769|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cacccccggaaacggcggtaacggcgg Protospacer
. .*** *****************
658. spacer 4.19|957909|27|NC_008769|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
659. spacer 4.19|957909|27|NC_008769|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
660. spacer 4.19|957909|27|NC_008769|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
661. spacer 4.19|957909|27|NC_008769|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
662. spacer 4.19|957909|27|NC_008769|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
663. spacer 4.19|957909|27|NC_008769|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
664. spacer 4.19|957909|27|NC_008769|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
665. spacer 4.19|957909|27|NC_008769|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
666. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
667. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
668. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
669. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
670. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
671. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
672. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
673. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
674. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
675. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
676. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
677. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
678. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
679. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
680. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
681. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
682. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
683. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
684. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
685. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
686. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
687. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
688. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
689. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
690. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
691. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
692. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
693. spacer 5.9|1243716|37|NC_008769|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
694. spacer 6.3|2089364|30|NC_008769|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
695. spacer 6.3|2089364|30|NC_008769|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
696. spacer 6.3|2089364|30|NC_008769|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
697. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 7, identity: 0.8
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggggacggcggcagcggcggcgggctct Protospacer
*********** ******.******** * **
698. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 7, identity: 0.8
cagcggcggggccggcggtagcggcggggccaact-- CRISPR spacer
aggcggcgcggccggcggcagcggc--ggccaacccg Protospacer
.****** *********.****** *******.
699. spacer 10.10|3928946|35|NC_008769|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.8
cgatg-gcgccgacggaggggcagccaccggcgtcg CRISPR spacer
-ggtgtgcgccgacggaggagcacccaccggggcag Protospacer
*.** *************.*** ******* *. *
700. spacer 11.2|4067200|36|NC_008769|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.806
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
gggcaacggcggggccggcgggccgctgaccgccac Protospacer
** *******************.**** .** .**
701. spacer 1.3|361813|30|NC_008769|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
702. spacer 1.12|362293|30|NC_008769|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
703. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
704. spacer 1.12|362293|30|NC_008769|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
705. spacer 1.12|362293|30|NC_008769|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
706. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
agttcgcggcggaatccgcggcggggaacg Protospacer
* . ******* *************. *
707. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
gcccttcggcggatgccgcggcggcgagct Protospacer
********** ********* ***
708. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
709. spacer 4.15|957723|30|NC_008769|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
710. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
711. spacer 4.15|957723|30|NC_008769|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
712. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
713. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
714. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
715. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
716. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
717. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
718. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
719. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
720. spacer 4.15|957723|30|NC_008769|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
721. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
722. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
723. spacer 4.15|957723|30|NC_008769|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
724. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
725. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
726. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
727. spacer 4.17|957819|30|NC_008769|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
728. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
729. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
730. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
731. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
732. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
733. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
734. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
735. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
736. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
737. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
738. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
739. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
740. spacer 4.17|957819|30|NC_008769|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
741. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
742. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
743. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
744. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
745. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
746. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
747. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
748. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
749. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
750. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
751. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
752. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
753. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
754. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
755. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
756. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
757. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
758. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
759. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
760. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
761. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
762. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
763. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
764. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
765. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
766. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
767. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
768. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
769. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
770. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
771. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
772. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
773. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
774. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
775. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
776. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
777. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
778. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
779. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
780. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
781. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
782. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
783. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
784. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
785. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
786. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
787. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
788. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
789. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
790. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
791. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
792. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
793. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
794. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
795. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
796. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
797. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
798. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
799. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
800. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
801. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
802. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
803. spacer 5.9|1243716|37|NC_008769|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
804. spacer 6.3|2089364|30|NC_008769|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
805. spacer 6.3|2089364|30|NC_008769|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
806. spacer 9.37|3076012|29|NC_008769|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
807. spacer 10.6|3928667|35|NC_008769|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
808. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
809. spacer 10.6|3928667|35|NC_008769|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
810. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
811. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
812. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
813. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
814. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
815. spacer 10.6|3928667|35|NC_008769|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggtgtcggcggtagcggcggcgaggtcg Protospacer
********* *.*************** * . *
816. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.771
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cagcggcggggacggcggcagcggcgtgcagcgct Protospacer
*********** ******.******* * .**
817. spacer 10.10|3928946|35|NC_008769|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.771
cgatggcgccgacggaggggcagccaccggcgtcg CRISPR spacer
catcgtcgccgacggaggggcgaccaccggcgact Protospacer
*. .* ***************..********* *
818. spacer 12.1|4067555|29|NC_008769|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.724
aacggtggtaacgccggagttggcacgcc CRISPR spacer
tccgctggtaacgccggagatggcattgt Protospacer
** ************** *****. .
819. spacer 1.13|362341|39|NC_008769|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
820. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
821. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
822. spacer 3.1|722933|31|NC_008769|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
823. spacer 4.8|957423|30|NC_008769|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.7
cggattcggcggattccgcggcggggaggg CRISPR spacer
tggatccggtggattccgcggcggccgcat Protospacer
.****.***.************** . .
824. spacer 4.15|957723|30|NC_008769|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
825. spacer 4.17|957819|30|NC_008769|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
826. spacer 4.17|957819|30|NC_008769|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
827. spacer 4.19|957909|27|NC_008769|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.667
gctgatcggcaacggcggtaacggcgg--------- CRISPR spacer
---------caacggcggtaacggcggtaacggcgg Protospacer
******************
828. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
829. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
830. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
831. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
832. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
833. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
834. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
835. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
836. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
837. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
838. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
839. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
840. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
841. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
842. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
843. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
844. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
845. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
846. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
847. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
848. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
849. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
850. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
851. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
852. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
853. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
854. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
855. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
856. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
857. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
858. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
859. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
860. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
861. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
862. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
863. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
864. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
865. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
866. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
867. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
868. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
869. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
870. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
871. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
872. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
873. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
874. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
875. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
876. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
877. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
878. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
879. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
880. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
881. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
882. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
883. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
884. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
885. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
886. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
887. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
888. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
889. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
890. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
891. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
892. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
893. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
894. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
895. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
896. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
897. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
898. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
899. spacer 5.9|1243716|37|NC_008769|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
900. spacer 8.9|3073261|37|NC_008769|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757
tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga Protospacer
** . . ***.************* **********
901. spacer 8.10|3073334|37|NC_008769|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757
tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga Protospacer
** . . ***.************* **********
902. spacer 9.17|3076598|39|NC_008769|CRISPRCasFinder,CRT matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
tcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
903. spacer 10.6|3928667|35|NC_008769|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.743
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
ggccggcggggccggcgggaccggcggggccgggg Protospacer
. *************** * **********..
904. spacer 10.6|3928667|35|NC_008769|CRT matches to MN908687 (Gordonia phage Skog, complete genome) position: , mismatch: 9, identity: 0.743
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cggcggcgggtccggcggtaacggcggtttcttca Protospacer
*.******** *********.****** .* *
905. spacer 4.2|957135|39|NC_008769|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
906. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
907. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
908. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
909. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
910. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
911. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
912. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
913. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
914. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
915. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
916. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
917. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
918. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
919. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
920. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
921. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
922. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
923. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
924. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
925. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
926. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
927. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
928. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
929. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
930. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
931. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
932. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
933. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
934. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
935. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
936. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
937. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
938. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
939. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
940. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
941. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
942. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
943. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
944. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
945. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
946. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
947. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
948. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
949. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
950. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
951. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
952. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
953. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
954. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
955. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
956. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
957. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
958. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
959. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
960. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
961. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
962. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
963. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
964. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
965. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
966. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
967. spacer 5.9|1243716|37|NC_008769|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
968. spacer 5.9|1243716|37|NC_008769|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
969. spacer 8.1|3072669|35|NC_008769|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
970. spacer 9.45|3076600|40|NC_008769|PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.75
ctcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
gagaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
971. spacer 10.6|3928667|35|NC_008769|CRT matches to MT498048 (Mycobacterium phage Raymond7, complete genome) position: , mismatch: 10, identity: 0.714
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcac Protospacer
*. .********************.** ** .
972. spacer 10.6|3928667|35|NC_008769|CRT matches to KF986246 (Mycobacterium phage MichelleMyBell, complete genome) position: , mismatch: 10, identity: 0.714
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
cgctggcggggccggcggtagcggtggcgcgtcac Protospacer
*. .********************.** ** .
973. spacer 10.6|3928667|35|NC_008769|CRT matches to NC_028791 (Mycobacterium phage MOOREtheMARYer, complete genome) position: , mismatch: 10, identity: 0.714
cagcggcggggccggcggtagcggcggggccaact CRISPR spacer
tggcggcggcgccggcggtaacggcggcgtgggca Protospacer
..******* **********.****** *. ..*
974. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
975. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
976. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
977. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
978. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
979. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
980. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
981. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
982. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
983. spacer 5.5|1243500|40|NC_008769|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
984. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
985. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
986. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
987. spacer 5.3|1243395|34|NC_008769|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*