Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011274 Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91, complete genome 2 crisprs WYL,DEDDh,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 10 4 0

Results visualization

1. NC_011274
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011274_1 2952177-2952329 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011274_2 2968478-2969117 TypeI-E I-E
10 spacers
cas8e,cse2gr11,cas7,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011274_2 2.6|2968812|33|NC_011274|CRISPRCasFinder 2968812-2968844 33 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63435 4 0.879
NC_011274_2 2.6|2968812|33|NC_011274|CRISPRCasFinder 2968812-2968844 33 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91355-91387 4 0.879
NC_011274_2 2.16|2968812|35|NC_011274|CRT,PILER-CR 2968812-2968846 35 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63437 5 0.857
NC_011274_2 2.16|2968812|35|NC_011274|CRT,PILER-CR 2968812-2968846 35 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91353-91387 5 0.857
NC_011274_2 2.17|2968874|34|NC_011274|CRT,PILER-CR 2968874-2968907 34 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18967-19000 5 0.853
NC_011274_2 2.17|2968874|34|NC_011274|CRT,PILER-CR 2968874-2968907 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25136-25169 5 0.853
NC_011274_1 1.2|2952275|28|NC_011274|PILER-CR 2952275-2952302 28 MN693671 Marine virus AFVG_250M196, complete genome 29244-29271 6 0.786
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18969-19000 6 0.812
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25138-25169 6 0.812
NC_011274_2 2.17|2968874|34|NC_011274|CRT,PILER-CR 2968874-2968907 34 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31716-31749 6 0.824
NC_011274_1 1.2|2952275|28|NC_011274|PILER-CR 2952275-2952302 28 MN693776 Marine virus AFVG_250M197, complete genome 4155-4182 7 0.75
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31718-31749 7 0.781
NC_011274_2 2.2|2968568|32|NC_011274|CRISPRCasFinder 2968568-2968599 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 329022-329053 8 0.75
NC_011274_2 2.8|2968935|32|NC_011274|CRISPRCasFinder 2968935-2968966 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
NC_011274_2 2.8|2968935|32|NC_011274|CRISPRCasFinder 2968935-2968966 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
NC_011274_2 2.12|2968568|34|NC_011274|CRT,PILER-CR 2968568-2968601 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
NC_011274_2 2.6|2968812|33|NC_011274|CRISPRCasFinder 2968812-2968844 33 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143783 9 0.727
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP048340 Escherichia coli strain 142 plasmid p142_C, complete sequence 2410-2441 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_LR130559 Escherichia coli strain MS14385 isolate MS14385 plasmid 5 41882-41913 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP020518 Escherichia coli strain 222 plasmid unnamed2, complete sequence 13450-13481 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP020497 Escherichia coli strain 103 plasmid unnamed2, complete sequence 37140-37171 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP040921 Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence 32060-32091 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 CP053252 Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence 19381-19412 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP042622 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence 2614-2645 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_LT985302 Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI 11943-11974 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP028194 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence 15383-15414 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 22646-22677 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 AP019710 Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome 4361-4392 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP024829 Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence 2221-2252 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP009861 Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence 2868-2899 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 CP025877 Escherichia coli strain 503458 plasmid p503458_49, complete sequence 18343-18374 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP023368 Escherichia coli strain 1428 plasmid p48, complete sequence 4914-4945 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP032259 Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence 23402-23433 9 0.719
NC_011274_2 2.7|2968874|32|NC_011274|CRISPRCasFinder 2968874-2968905 32 NZ_CP037450 Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence 15851-15882 9 0.719
NC_011274_2 2.8|2968935|32|NC_011274|CRISPRCasFinder 2968935-2968966 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
NC_011274_2 2.10|2969057|32|NC_011274|CRISPRCasFinder 2969057-2969088 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
NC_011274_2 2.5|2968751|32|NC_011274|CRISPRCasFinder 2968751-2968782 32 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 103231-103262 10 0.688
NC_011274_2 2.10|2969057|32|NC_011274|CRISPRCasFinder 2969057-2969088 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688
NC_011274_2 2.16|2968812|35|NC_011274|CRT,PILER-CR 2968812-2968846 35 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143785 11 0.686

1. spacer 2.6|2968812|33|NC_011274|CRISPRCasFinder matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg	Protospacer
************.***************.  **

2. spacer 2.6|2968812|33|NC_011274|CRISPRCasFinder matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatg	Protospacer
************.***************.  **

3. spacer 2.16|2968812|35|NC_011274|CRT,PILER-CR matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc	Protospacer
************.***************.  *** 

4. spacer 2.16|2968812|35|NC_011274|CRT,PILER-CR matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
tcaggaacgcgcagcggaagagcttggtaaatgcc	Protospacer
************.***************.  *** 

5. spacer 2.17|2968874|34|NC_011274|CRT,PILER-CR matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa----	Protospacer
* *************************    ***    

6. spacer 2.17|2968874|34|NC_011274|CRT,PILER-CR matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgcctttcccggagttccggccccttctcaaa----	Protospacer
* *************************    ***    

7. spacer 1.2|2952275|28|NC_011274|PILER-CR matches to MN693671 (Marine virus AFVG_250M196, complete genome) position: , mismatch: 6, identity: 0.786

gtgatcagcggcggatgaatttgccctg	CRISPR spacer
accatcagcggcggatgaatttgcagtt	Protospacer
.. *********************  * 

8. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgcctttcccggagttccggccccttctca	Protospacer
* *************************   . 

9. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgcctttcccggagttccggccccttctca	Protospacer
* *************************   . 

10. spacer 2.17|2968874|34|NC_011274|CRT,PILER-CR matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824

gctgcctttcccggagttccggcccct----aaattgg	CRISPR spacer
ggtgccttttccggagttccggccccttctcaaa----	Protospacer
* *******.*****************    ***    

11. spacer 1.2|2952275|28|NC_011274|PILER-CR matches to MN693776 (Marine virus AFVG_250M197, complete genome) position: , mismatch: 7, identity: 0.75

gtgatcagcggcggatgaatttgccctg	CRISPR spacer
accatcagcggcggatgaatttgcaggt	Protospacer
.. *********************    

12. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
ggtgccttttccggagttccggccccttctca	Protospacer
* *******.*****************   . 

13. spacer 2.2|2968568|32|NC_011274|CRISPRCasFinder matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cgattctacggcaacaggccaggctgcgaccg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcg	Protospacer
 *    .********** ***********.**

14. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75

gctgcctttcccggagttccggcccctaaatt---	CRISPR spacer
tatgcctttcccggctttccggccc---aactgac	Protospacer
  ************  *********   **.*   

15. spacer 2.8|2968935|32|NC_011274|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

16. spacer 2.8|2968935|32|NC_011274|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

17. spacer 2.12|2968568|34|NC_011274|CRT,PILER-CR matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgattctacggcaacaggccaggctgcgaccgcg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcgcg	Protospacer
 *    .********** ***********.****

18. spacer 2.6|2968812|33|NC_011274|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

tcaggaacgcgcggcggaagagcttggtgtttg	CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttc	Protospacer
..  *  **.*********** ********** 

19. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

20. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

21. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

22. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

23. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

24. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

25. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

26. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

27. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

28. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

29. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

30. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

31. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

32. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

33. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

34. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

35. spacer 2.7|2968874|32|NC_011274|CRISPRCasFinder matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

gctgcctttcccggagttccggcccctaaatt	CRISPR spacer
gtgccctttaccggagttccggccccttctca	Protospacer
*.  ***** *****************   . 

36. spacer 2.8|2968935|32|NC_011274|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa	Protospacer
 * ********** ***.********    *.

37. spacer 2.10|2969057|32|NC_011274|CRISPRCasFinder matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gaatctggagggcgacagcgcggtcgaccctg	Protospacer
*********** *.*********. .* .*. 

38. spacer 2.5|2968751|32|NC_011274|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

atcaaacatggaaacccctttaatgagagcaa	CRISPR spacer
ctaaaacatggaaaccactgtaatgacgaatc	Protospacer
 * ************* ** ****** ..   

39. spacer 2.10|2969057|32|NC_011274|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gtggtcataggccatcagcgcggcgatatccc	Protospacer
* . ... ****** *********** ****.

40. spacer 2.16|2968812|35|NC_011274|CRT,PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

tcaggaacgcgcggcggaagagcttggtgtttgcg	CRISPR spacer
ctttgcccgtgcggcggaagaccttggtgtttctc	Protospacer
..  *  **.*********** ********** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1262954 : 1339908 81 Enterobacteria_phage(29.79%) lysis,holin,protease,integrase,terminase,tail,portal attL 1305308:1305326|attR 1314915:1314933
DBSCAN-SWA_2 2166568 : 2177075 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 2244267 : 2253436 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 2489740 : 2495821 6 Salmonella_virus(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage