Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012491 Brevibacillus brevis NBRC 100599, complete genome 2 crisprs csa3,WYL,cas14j,RT,DEDDh,Cas14u_CAS-V,DinG,cas3 1 0 8 0

Results visualization

1. NC_012491
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012491_1 502645-502759 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012491_2 2232716-2232865 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_012491_2 2.3|2232818|30|NC_012491|CRT 2232818-2232847 30 NC_012491.1 2232986-2233015 2 0.933

1. spacer 2.3|2232818|30|NC_012491|CRT matches to position: 2232986-2233015, mismatch: 2, identity: 0.933

accaaatgtcagaccgaacgtaaggccaaa	CRISPR spacer
accaaatatcagaccgaatgtaaggccaaa	Protospacer
*******.**********.***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 616721 : 624591 7 Geobacillus_virus(16.67%) transposase NA
DBSCAN-SWA_2 3012342 : 3133601 68 Geobacillus_phage(18.75%) plate,capsid,head,protease,holin,terminase,portal,tail NA
DBSCAN-SWA_3 3694048 : 3743737 60 Bacillus_phage(30.43%) plate,capsid,protease,tRNA,holin,terminase,portal,tail NA
DBSCAN-SWA_4 3751850 : 3758815 9 Bacillus_phage(28.57%) NA NA
DBSCAN-SWA_5 3938792 : 3947045 10 Cyanophage(16.67%) tail NA
DBSCAN-SWA_6 4412606 : 4455782 37 Bacillus_phage(42.86%) bacteriocin,plate,tail NA
DBSCAN-SWA_7 5664838 : 5692356 37 Geobacillus_phage(28.57%) plate,capsid,head,protease,holin,terminase,portal,tail NA
DBSCAN-SWA_8 6213462 : 6222827 10 Caulobacter_phage(42.86%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage