Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 6 crisprs cas14j,c2c10_CAS-V-U3,c2c4_V-U1,cas6e,cas5,cas7,cas8e,cas14k 0 16 1 0
NC_010376 Finegoldia magna ATCC 29328, complete genome 1 crisprs cas9,cas1,cas2,csn2,PD-DExK,cas3,DEDDh,DinG,csa3 0 12 3 0

Results visualization

1. NC_010371
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_1 4137-4234 TypeV NA
1 spacers
cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_2 27441-27546 TypeV NA
1 spacers
c2c10_CAS-V-U3,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_3 45598-45810 TypeI-E I-C,I-E,II-B
3 spacers
cas6e,cas5,cas7,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_4 45891-46284 TypeI-E I-C,I-E,II-B
6 spacers
cas6e,cas5,cas7,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_5 79415-79559 TypeV NA
2 spacers
cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010371_6 79626-79852 TypeV NA
3 spacers
cas14k

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010371_1 1.1|4170|32|NC_010371|CRISPRCasFinder 4170-4201 32 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 4170-4201 0 1.0
NC_010371_2 2.1|27469|50|NC_010371|CRISPRCasFinder 27469-27518 50 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 27469-27518 0 1.0
NC_010371_3 3.1|45626|34|NC_010371|CRISPRCasFinder 45626-45659 34 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 45626-45659 0 1.0
NC_010371_3 3.2|45688|33|NC_010371|CRISPRCasFinder 45688-45720 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 45688-45720 0 1.0
NC_010371_3 3.3|45749|33|NC_010371|CRISPRCasFinder 45749-45781 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 45749-45781 0 1.0
NC_010371_4 4.1|45919|33|NC_010371|CRISPRCasFinder 45919-45951 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 45919-45951 0 1.0
NC_010371_4 4.2|45980|32|NC_010371|CRISPRCasFinder 45980-46011 32 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 45980-46011 0 1.0
NC_010371_4 4.3|46040|33|NC_010371|CRISPRCasFinder 46040-46072 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 46040-46072 0 1.0
NC_010371_4 4.4|46101|34|NC_010371|CRISPRCasFinder 46101-46134 34 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 46101-46134 0 1.0
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 46163-46195 0 1.0
NC_010371_4 4.6|46224|33|NC_010371|CRISPRCasFinder 46224-46256 33 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 46224-46256 0 1.0
NC_010371_5 5.1|79441|34|NC_010371|CRISPRCasFinder 79441-79474 34 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 79441-79474 0 1.0
NC_010371_5 5.2|79501|32|NC_010371|CRISPRCasFinder 79501-79532 32 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 79501-79532 0 1.0
NC_010371_6 6.1|79652|59|NC_010371|CRISPRCasFinder 79652-79710 59 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 79652-79710 0 1.0
NC_010371_6 6.2|79737|36|NC_010371|CRISPRCasFinder 79737-79772 36 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 79737-79772 0 1.0
NC_010371_6 6.3|79799|28|NC_010371|CRISPRCasFinder 79799-79826 28 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 79799-79826 0 1.0
NC_010371_4 4.2|45980|32|NC_010371|CRISPRCasFinder 45980-46011 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 64894-64925 5 0.844
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 KP836356 Marinitoga camini virus 2, complete genome 436-468 7 0.788
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 KP836355 Marinitoga camini virus 1, complete genome 44548-44580 7 0.788
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 MN694532 Marine virus AFVG_250M629, complete genome 32165-32197 7 0.788
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NC_022111 Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence 370552-370584 8 0.758
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NZ_CP029459 Clostridium novyi strain 150557 plasmid pCN1, complete sequence 44853-44885 8 0.758
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NZ_AP017916 Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ2 DNA, complete sequence, phylotype ProJPt-1 20592-20624 8 0.758
NC_010371_4 4.2|45980|32|NC_010371|CRISPRCasFinder 45980-46011 32 AP014348 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C73, *** SEQUENCING IN PROGRESS *** 8822-8853 9 0.719
NC_010371_3 3.2|45688|33|NC_010371|CRISPRCasFinder 45688-45720 33 NZ_CP012711 Psychrobacter urativorans strain R310.10B plasmid 5, complete sequence 33924-33956 10 0.697
NC_010371_4 4.4|46101|34|NC_010371|CRISPRCasFinder 46101-46134 34 NZ_CP033579 Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence 159213-159246 10 0.706
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NZ_CP025502 Clostridium perfringens strain EHE-NE18 plasmid pJIR3535, complete sequence 39671-39703 10 0.697
NC_010371_4 4.5|46163|33|NC_010371|CRISPRCasFinder 46163-46195 33 NC_019688 Clostridium perfringens plasmid pNetB-NE10, complete sequence 63516-63548 10 0.697

1. spacer 1.1|4170|32|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

tctgggggcgaaagacgacaacttggggaggt	CRISPR spacer
tctgggggcgaaagacgacaacttggggaggt	Protospacer
********************************

2. spacer 2.1|27469|50|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

gttccatttgatcttcatcaaactcaggctttgcatacacactaacatct	CRISPR spacer
gttccatttgatcttcatcaaactcaggctttgcatacacactaacatct	Protospacer
**************************************************

3. spacer 3.1|45626|34|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

attgtgctgttttagggcctccagtatcttccct	CRISPR spacer
attgtgctgttttagggcctccagtatcttccct	Protospacer
**********************************

4. spacer 3.2|45688|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

ctcaacaccgttgttgttatttacattattaac	CRISPR spacer
ctcaacaccgttgttgttatttacattattaac	Protospacer
*********************************

5. spacer 3.3|45749|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

ctgtggacaaaatctgtaacataacaatcctat	CRISPR spacer
ctgtggacaaaatctgtaacataacaatcctat	Protospacer
*********************************

6. spacer 4.1|45919|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

taagtatttattacgaaaagttcatagataaaa	CRISPR spacer
taagtatttattacgaaaagttcatagataaaa	Protospacer
*********************************

7. spacer 4.2|45980|32|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

cttattcgattcttcatttttttagttctctt	CRISPR spacer
cttattcgattcttcatttttttagttctctt	Protospacer
********************************

8. spacer 4.3|46040|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

cttattgttgaaattatctttgtttttagagtt	CRISPR spacer
cttattgttgaaattatctttgtttttagagtt	Protospacer
*********************************

9. spacer 4.4|46101|34|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

tgctgtgtcaaatgcaaaagaagatgttttaaat	CRISPR spacer
tgctgtgtcaaatgcaaaagaagatgttttaaat	Protospacer
**********************************

10. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

cataaagttataattataatctttttttataac	CRISPR spacer
cataaagttataattataatctttttttataac	Protospacer
*********************************

11. spacer 4.6|46224|33|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

tcatagatacttttttcgctccttgaaataatc	CRISPR spacer
tcatagatacttttttcgctccttgaaataatc	Protospacer
*********************************

12. spacer 5.1|79441|34|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

ttattaacctatgcaacattagtgaattccttct	CRISPR spacer
ttattaacctatgcaacattagtgaattccttct	Protospacer
**********************************

13. spacer 5.2|79501|32|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

aaggttaattgtccttaatcttgttatcccac	CRISPR spacer
aaggttaattgtccttaatcttgttatcccac	Protospacer
********************************

14. spacer 6.1|79652|59|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

caaacgttacacttactgaaatacacttgctattgcaagaaaagacagttacggtaaca	CRISPR spacer
caaacgttacacttactgaaatacacttgctattgcaagaaaagacagttacggtaaca	Protospacer
***********************************************************

15. spacer 6.2|79737|36|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

aatattatagtatcttgactatttggctaaatgatc	CRISPR spacer
aatattatagtatcttgactatttggctaaatgatc	Protospacer
************************************

16. spacer 6.3|79799|28|NC_010371|CRISPRCasFinder matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 0, identity: 1.0 

ctttcaggacacttatgccaaattttct	CRISPR spacer
ctttcaggacacttatgccaaattttct	Protospacer
****************************

17. spacer 4.2|45980|32|NC_010371|CRISPRCasFinder matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 5, identity: 0.844 

cttattcgattcttcatttttttagttctctt	CRISPR spacer
cttattcaattcttcatttttttatttccact	Protospacer
*******.**************** ***. .*

18. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to KP836356 (Marinitoga camini virus 2, complete genome) position: , mismatch: 7, identity: 0.788 

cataaagttataattataatctttttttataac	CRISPR spacer
tttatcgccataattataatatttttttataac	Protospacer
. **  *..*********** ************

19. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to KP836355 (Marinitoga camini virus 1, complete genome) position: , mismatch: 7, identity: 0.788 

cataaagttataattataatctttttttataac	CRISPR spacer
tttattgccataattataatatttttttataac	Protospacer
. **  *..*********** ************

20. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to MN694532 (Marine virus AFVG_250M629, complete genome) position: , mismatch: 7, identity: 0.788 

cataaagttataattataatctttttttataac	CRISPR spacer
cgtctatttataattataatcattatttataat	Protospacer
*.*  * ************** ** *******.

21. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 8, identity: 0.758 

----cataaagttataattataatctttttttataac	CRISPR spacer
tcgtttta----tataattataatcattttttattac	Protospacer
    . **    ************* ******** **

22. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NZ_CP029459 (Clostridium novyi strain 150557 plasmid pCN1, complete sequence) position: , mismatch: 8, identity: 0.758 

cataaagttataat---tataatctttttttataac	CRISPR spacer
---atatttattattaatataatctttttttatatt	Protospacer
   * * **** **   ***************** .

23. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NZ_AP017916 (Candidatus Azobacteroides pseudotrichonymphae plasmid pAPPJ2 DNA, complete sequence, phylotype ProJPt-1) position: , mismatch: 8, identity: 0.758 

cata-aagttataattataatctttttttataac	CRISPR spacer
-gtatactttataattataatctttgcttatagt	Protospacer
 .** *  ***************** .*****..

24. spacer 4.2|45980|32|NC_010371|CRISPRCasFinder matches to AP014348 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C73, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719 

cttattcgattcttcatttttttagttctctt	CRISPR spacer
tacctgtaattcttaatttttttaattctctt	Protospacer
. . * ..****** *********.*******

25. spacer 3.2|45688|33|NC_010371|CRISPRCasFinder matches to NZ_CP012711 (Psychrobacter urativorans strain R310.10B plasmid 5, complete sequence) position: , mismatch: 10, identity: 0.697 

ctcaacaccgttgttgttatttacattattaac	CRISPR spacer
gataggtaagttgctgatatttacattattaac	Protospacer
  .*.    ****.** ****************

26. spacer 4.4|46101|34|NC_010371|CRISPRCasFinder matches to NZ_CP033579 (Vibrio mediterranei strain 117-T6 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706 

tgctgtgtcaaatgcaaaagaagatgttttaaat	CRISPR spacer
tataagttttaatgctaatgaagatgttttaaat	Protospacer
*.. .  *. ***** ** ***************

27. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NZ_CP025502 (Clostridium perfringens strain EHE-NE18 plasmid pJIR3535, complete sequence) position: , mismatch: 10, identity: 0.697 

cataaagttataattataatctttttttataac	CRISPR spacer
ttctttattataattataatttatttttataat	Protospacer
. .   .*************.* *********.

28. spacer 4.5|46163|33|NC_010371|CRISPRCasFinder matches to NC_019688 (Clostridium perfringens plasmid pNetB-NE10, complete sequence) position: , mismatch: 10, identity: 0.697 

cataaagttataattataatctttttttataac	CRISPR spacer
ttctttattataattataatttatttttataat	Protospacer
. .   .*************.* *********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 65905 : 132825 55 Geobacillus_virus(18.18%) transposase,integrase attL 74932:74952|attR 118286:118306

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_010376
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010376_1 79845-80806 TypeII NA
14 spacers
csn2,cas2,cas1,cas9,csa3,PD-DExK

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 MK250029 Prevotella phage Lak-C1, complete genome 60399-60429 3 0.903
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 MN694190 Marine virus AFVG_250M608, complete genome 21783-21813 5 0.839
NC_010376_1 1.3|80013|30|NC_010376|CRISPRCasFinder,CRT 80013-80042 30 NZ_CP011146 Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence 184505-184534 6 0.8
NC_010376_1 1.4|80079|30|NC_010376|CRISPRCasFinder,CRT 80079-80108 30 MK288021 Bacillus phage pW2, complete genome 101480-101509 6 0.8
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 CP008937 Candidatus Caedibacter acanthamoebae plasmid Plasmid_00001, complete sequence 147905-147934 6 0.8
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 CP008940 Candidatus Caedibacter acanthamoebae plasmid Plasmid_00004, complete sequence 12302-12331 6 0.8
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 174586-174615 6 0.8
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP044166 Campylobacter coli strain AR-0416 plasmid pAR-0416 177439-177468 6 0.8
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP017416 Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence 42155-42184 6 0.8
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_022354 Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence 6345-6374 6 0.8
NC_010376_1 1.10|80475|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80475-80504 30 KX905163 Clostridioides phage phiSemix9P1, complete genome 45263-45292 6 0.8
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP024398 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp27, complete sequence 17986-18016 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP024360 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-6 17984-18014 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP024214 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-7 8640-8670 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP015325 Bacillus filamentosus strain Hbe603 plasmid pBEH3, complete sequence 23396-23426 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 49671-49701 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 307485-307515 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 176205-176235 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 293206-293236 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 176205-176235 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 175713-175743 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 31176-31206 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NC_022603 Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence 31469-31499 6 0.806
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 314973-315003 6 0.806
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 165-194 7 0.767
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 MT774383 CrAssphage cr11_1, complete genome 1353-1382 7 0.767
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP013709 Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence 46074-46103 7 0.767
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 92159-92188 7 0.767
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NC_019773 Anabaena cylindrica PCC 7122 plasmid pANACY.03, complete sequence 106239-106269 7 0.774
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP032858 Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence 105031-105061 7 0.774
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP032873 Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence 126068-126098 7 0.774
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP029459 Clostridium novyi strain 150557 plasmid pCN1, complete sequence 39625-39655 7 0.774
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP048057 Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p1, complete sequence 2520-2550 7 0.774
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_AP019380 Buchnera aphidicola (Nipponaphis monzeni) strain Nmo isolate Tokyo2014 plasmid pLeu, complete sequence 10194-10224 7 0.774
NC_010376_1 1.2|79947|30|NC_010376|CRISPRCasFinder,CRT 79947-79976 30 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 982401-982430 8 0.733
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 250653-250682 8 0.733
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 254221-254250 8 0.733
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 NZ_CP032696 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence 480789-480818 8 0.733
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP030090 Lactobacillus reuteri strain YSJL-12 plasmid unnamed1, complete sequence 40864-40893 8 0.733
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP007648 Lactobacillus salivarius strain JCM1046 plasmid pMP1046B, complete sequence 18509-18538 8 0.733
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP034875 Buchnera aphidicola (Hyadaphis tataricae) strain Hta plasmid pTrp, complete sequence 2528-2557 8 0.733
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP015507 Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence 197807-197836 8 0.733
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 CP015514 Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence 574350-574379 8 0.733
NC_010376_1 1.8|80343|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80343-80372 30 MW073017 Vibrio phage Va2, complete genome 120492-120521 8 0.733
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP036488 Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence 38631-38661 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP034838 Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence 124373-124403 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP034839 Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence 124373-124403 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP034837 Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence 102285-102315 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP032297 Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence 524358-524388 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 120935-120965 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 124105-124135 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 540668-540698 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_AP022840 Legionella sp. TUM19329 plasmid pTUM19329-1 65656-65686 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP029455 Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence 268944-268974 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 225089-225119 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 807547-807577 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 807563-807593 8 0.742
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP028885 Borrelia turcica IST7 plasmid lp129, complete sequence 6624-6654 8 0.742
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 NC_020879 Aeromonas phage Aes012, complete genome 38853-38882 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 MH179477 Aeromonas phage 60AhydR15PP, complete genome 65532-65561 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 NC_008208 Aeromonas phage 25, complete genome 38297-38326 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 NC_014635 Aeromonas phage phiAS4, complete genome 130897-130926 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 DQ529280 Aeromonas salmonicida bacteriophage 25, complete genome 38297-38326 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 MF479730 Aeromonas phage AS-gz, complete genome 120228-120257 9 0.7
NC_010376_1 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT 79881-79910 30 NC_019543 Aeromonas phage Aes508, complete genome 39258-39287 9 0.7
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 NZ_KY000074 Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence 77773-77802 9 0.7
NC_010376_1 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT 80145-80174 30 MG962366 Rhodococcus phage Finch, complete genome 122122-122151 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP029743 Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence 20436-20465 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_018990 Borrelia burgdorferi 297 plasmid 297_lp28-3, complete sequence 11820-11849 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_011781 Borreliella burgdorferi ZS7 plasmid ZS7_lp28-3, complete sequence 14756-14785 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_017405 Borreliella burgdorferi JD1 plasmid JD1 lp28-3, complete sequence 13798-13827 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP031402 Borreliella burgdorferi strain MM1 plasmid plsm_lp28-3, complete sequence 13164-13193 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_001853 Borreliella burgdorferi B31 plasmid lp28-3, complete sequence 13790-13819 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NZ_CP017213 Borreliella burgdorferi strain B331 plasmid B331_lp28_3, complete sequence 12387-12416 9 0.7
NC_010376_1 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80277-80306 30 NC_021503 Lactobacillus reuteri I5007 plasmid pLRI01, complete sequence 22536-22565 9 0.7
NC_010376_1 1.8|80343|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80343-80372 30 JQ680349 Unidentified phage clone 1013_scaffold24 genomic sequence 35707-35736 9 0.7
NC_010376_1 1.9|80409|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80409-80438 30 NZ_CP014002 Synechococcus sp. PCC 73109 plasmid unnamed4, complete sequence 9196-9225 9 0.7
NC_010376_1 1.11|80541|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80541-80571 31 NZ_CP048285 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence 9734-9764 9 0.71
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP014149 Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence 20836-20866 9 0.71
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 NZ_CP015595 Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence 31813-31843 9 0.71
NC_010376_1 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80608-80638 31 MN694024 Marine virus AFVG_250M601, complete genome 25826-25856 9 0.71
NC_010376_1 1.13|80675|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR 80675-80704 30 CP041751 Bacillus paranthracis strain NCCP 14796 plasmid unnamed1, complete sequence 10614-10643 9 0.7

1. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to MK250029 (Prevotella phage Lak-C1, complete genome) position: , mismatch: 3, identity: 0.903 

aatgataatttaaaagaatacttaatttata-	CRISPR spacer
aatgataatttaaaataataattaa-ttatat	Protospacer
*************** **** **** *****

2. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 5, identity: 0.839 

aatgataatttaaaagaatacttaatttata-	CRISPR spacer
tttgttaattcaaaagaatacttaa-ttatat	Protospacer
  ** *****.************** *****

3. spacer 1.3|80013|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP011146 (Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence) position: , mismatch: 6, identity: 0.8 

agtacgaatttggatttactccaaacgacg	CRISPR spacer
ataaagaacatggatttactccaaacgacc	Protospacer
*  * ***. *******************

4. spacer 1.4|80079|30|NC_010376|CRISPRCasFinder,CRT matches to MK288021 (Bacillus phage pW2, complete genome) position: , mismatch: 6, identity: 0.8 

ggattaggtgaacatacaattacagttact	CRISPR spacer
ctagcaggtgaacacacaattacagttaat	Protospacer
  * .*********.************* *

5. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to CP008937 (Candidatus Caedibacter acanthamoebae plasmid Plasmid_00001, complete sequence) position: , mismatch: 6, identity: 0.8 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
gtaaacatgatgaggtcaaggatttgaaga	Protospacer
 .**** ********************

6. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to CP008940 (Candidatus Caedibacter acanthamoebae plasmid Plasmid_00004, complete sequence) position: , mismatch: 6, identity: 0.8 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
gtaaacatgatgaggtcaaggatttgaaga	Protospacer
 .**** ********************

7. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 6, identity: 0.8 

ttgctatttttgttttaatcttt---agttccc	CRISPR spacer
ttgctatttttgtatgaatctttctaagct---	Protospacer
************* * *******   **.*

8. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044166 (Campylobacter coli strain AR-0416 plasmid pAR-0416) position: , mismatch: 6, identity: 0.8 

ttgctatttttgttttaatcttt---agttccc	CRISPR spacer
ttgctatttttgtatgaatctttctaagct---	Protospacer
************* * *******   **.*

9. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017416 (Campylobacter jejuni strain MTVDSCj07 plasmid pMTVDSCj07-1, complete sequence) position: , mismatch: 6, identity: 0.8 

ttgctatttttgttttaatcttt---agttccc	CRISPR spacer
ttgctatttttgtatgaatctttctaagct---	Protospacer
************* * *******   **.*

10. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_022354 (Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

ttgctatttttgttttaatcttt---agttccc	CRISPR spacer
ttgctatttttgtatgaatctttctaagct---	Protospacer
************* * *******   **.*

11. spacer 1.10|80475|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to KX905163 (Clostridioides phage phiSemix9P1, complete genome) position: , mismatch: 6, identity: 0.8 

tggttataaaaaaccgaaagcagaagtgaa	CRISPR spacer
tagttataaaaaagcaaaagcagaaataga	Protospacer
*.*********** *.*********.*..*

12. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024398 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp27, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aaaaaagatttaaaaaaatacttagtttata	Protospacer
** .* .********.********.******

13. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024360 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-6) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aaaaaagatttaaaaaaatacttagtttata	Protospacer
** .* .********.********.******

14. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024214 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-7) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aaaaaagatttaaaaaaatacttagtttata	Protospacer
** .* .********.********.******

15. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015325 (Bacillus filamentosus strain Hbe603 plasmid pBEH3, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgttaatttaaaagagtacttagagaata	Protospacer
**** ************.******.   ***

16. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

17. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

18. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

19. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

20. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

21. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

22. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

23. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_022603 (Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata-	CRISPR spacer
attgataatttagaagaatatttaa-aaatat	Protospacer
* **********.*******.****   ***

24. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.806 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
agtgatattttaaaagtatacttaaaggata	Protospacer
*.***** ******** ********   ***

25. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
tttatcctcgtctgactcttttcatctagc	Protospacer
************ .*********  *  .*

26. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to MT774383 (CrAssphage cr11_1, complete genome) position: , mismatch: 7, identity: 0.767 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
ataaacttgatgatgtcaagcatttatttg	Protospacer
 .*********** ****** ****. **

27. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013709 (Clostridium botulinum strain F634 plasmid pRSJ2_2, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
gatatagttttgttttaatctttacttcac	Protospacer
    ** ***************** *** *

28. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 7, identity: 0.767 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
gatatagttttgttttaatctttacttcac	Protospacer
    ** ***************** *** *

29. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_019773 (Anabaena cylindrica PCC 7122 plasmid pANACY.03, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
ggttctaatttaaaagaatatttaatttaac	Protospacer
..*  ***************.********

30. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032858 (Bacillus subtilis subsp. subtilis strain 2RL2-3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
gttgggaattttcaagaatacttaatttatg	Protospacer
. **. *****  *****************.

31. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032873 (Bacillus subtilis subsp. subtilis strain 2KL1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
gttgggaattttcaagaatacttaatttatg	Protospacer
. **. *****  *****************.

32. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029459 (Clostridium novyi strain 150557 plasmid pCN1, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
attgatgaattaaaagaatacttaatgttag	Protospacer
* ****.* ***************** *  .

33. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048057 (Piscirickettsia salmonis strain Ps-8942B plasmid Ps8942B-p1, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
ctttaaaatttaaaaaaatatttaatttatt	Protospacer
  * * *********.****.*********

34. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019380 (Buchnera aphidicola (Nipponaphis monzeni) strain Nmo isolate Tokyo2014 plasmid pLeu, complete sequence) position: , mismatch: 7, identity: 0.774 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aacatttttttaaaaaaatacttaatttatt	Protospacer
**.. *  *******.**************

35. spacer 1.2|79947|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 8, identity: 0.733 

tatggtggagatgaggagtatcgtacgaac	CRISPR spacer
gatggtggagatgaggcgcatcgtgcatca	Protospacer
 *************** *.*****.*.

36. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
tcgaacgtgatgaggtcaaggattcaccac	Protospacer
**.*** *****************.. . .

37. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
tcgaacgtgatgaggtcaaggattcaccac	Protospacer
**.*** *****************.. . .

38. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
tgcgttctgatgaggacaaggctttgattt	Protospacer
*  . ..******** ***** ********

39. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030090 (Lactobacillus reuteri strain YSJL-12 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
gagctatttttgtcttaatctttagaggat	Protospacer
  ***********.***********    .

40. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007648 (Lactobacillus salivarius strain JCM1046 plasmid pMP1046B, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgcta--tttttgttttaatctttagttccc	CRISPR spacer
--aataattttttgtgttaatctttagttgtt	Protospacer
  . **  ******* ************* ..

41. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034875 (Buchnera aphidicola (Hyadaphis tataricae) strain Hta plasmid pTrp, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
ttgatatttttgtattaatcttttttatat	Protospacer
*** ********* *********  * . .

42. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015507 (Bacillus oceanisediminis 2691 plasmid pBO1, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
tgcatatttttgttgtaatctttatttgat	Protospacer
*   ********** ********* **  .

43. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to CP015514 (Vibrio vulnificus strain FORC_036 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
tgagtatttttgtttttatatttagttaaa	Protospacer
* . ************ ** *******

44. spacer 1.8|80343|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to MW073017 (Vibrio phage Va2, complete genome) position: , mismatch: 8, identity: 0.733 

atactgattaatctgaatggtttgagtgat	CRISPR spacer
tctatgctcaatctgaatggtttgagttct	Protospacer
 .  ** *.******************  *

45. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036488 (Rahnella aquatilis strain MEM40 plasmid pMEM40-1, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagcaatttaaaagaatagttaatttatt	Protospacer
 . ...************** *********

46. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034838 (Rahnella aquatilis strain KM12 plasmid pKM12v1, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagcaatttaaaagaatagttaatttatt	Protospacer
 . ...************** *********

47. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034839 (Rahnella aquatilis strain KM25 plasmid pKM12v2, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagcaatttaaaagaatagttaatttatt	Protospacer
 . ...************** *********

48. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034837 (Rahnella aquatilis strain KM05 plasmid pKM05, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagcaatttaaaagaatagttaatttatt	Protospacer
 . ...************** *********

49. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032297 (Rahnella aquatilis strain ZF7 plasmid pRAZF7, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagcaatttaaaagaatagttaatttatt	Protospacer
 . ...************** *********

50. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagtgatttaaaagaatagttaatttatt	Protospacer
 . ..*.************* *********

51. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tgaagtgatttaaaagaatagttaatttatt	Protospacer
 . ..*.************* *********

52. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgataatttgaaagtatacttatccagtc	Protospacer
***********.**** ******* .. .*

53. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022840 (Legionella sp. TUM19329 plasmid pTUM19329-1) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
ttacatcatttaaaggaatacttaatttttt	Protospacer
    ** *******.************* *

54. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029455 (Bacillus cereus strain FORC087 plasmid pFORC087.1, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgataatttgaaagtatacttatccagtc	Protospacer
***********.**** ******* .. .*

55. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgttaatttaaatgaatactttaaaaaac	Protospacer
**** ********* ******** *   *

56. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgttaatttaaatgaatactttaaaaaac	Protospacer
**** ********* ******** *   *

57. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
aatgttaatttaaatgaatactttaaaaaac	Protospacer
**** ********* ******** *   *

58. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028885 (Borrelia turcica IST7 plasmid lp129, complete sequence) position: , mismatch: 8, identity: 0.742 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
acatattattttaaagaatacttaattaagg	Protospacer
*   ** **** *************** * .

59. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to NC_020879 (Aeromonas phage Aes012, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

60. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to MH179477 (Aeromonas phage 60AhydR15PP, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

61. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

62. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

63. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

64. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to MF479730 (Aeromonas phage AS-gz, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

65. spacer 1.1|79881|30|NC_010376|CRISPRCasFinder,CRT matches to NC_019543 (Aeromonas phage Aes508, complete genome) position: , mismatch: 9, identity: 0.7 

tttatcctcgtcaaactcttttccacacac	CRISPR spacer
gtatggaccgtcaaactcgtttccacacaa	Protospacer
 *     .********** **********

66. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to NZ_KY000074 (Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence) position: , mismatch: 9, identity: 0.7 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
agcgacttgatcaggtcgaggatttgaccc	Protospacer
   .******* *****.*********...

67. spacer 1.5|80145|30|NC_010376|CRISPRCasFinder,CRT matches to MG962366 (Rhodococcus phage Finch, complete genome) position: , mismatch: 9, identity: 0.7 

tcaaacttgatgaggtcaaggatttgattt	CRISPR spacer
aggtgctggatgaggtcaaggatctgatcc	Protospacer
  . .** ***************.****..

68. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029743 (Escherichia coli strain AR_0085 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
acgctatttttgttttaatccttatgagaa	Protospacer
 .******************.***

69. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_018990 (Borrelia burgdorferi 297 plasmid 297_lp28-3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

70. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_011781 (Borreliella burgdorferi ZS7 plasmid ZS7_lp28-3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

71. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_017405 (Borreliella burgdorferi JD1 plasmid JD1 lp28-3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

72. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031402 (Borreliella burgdorferi strain MM1 plasmid plsm_lp28-3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

73. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_001853 (Borreliella burgdorferi B31 plasmid lp28-3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

74. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017213 (Borreliella burgdorferi strain B331 plasmid B331_lp28_3, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
taaacttttttgttttaatctttaattatt	Protospacer
* . . ******************.** ..

75. spacer 1.7|80277|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NC_021503 (Lactobacillus reuteri I5007 plasmid pLRI01, complete sequence) position: , mismatch: 9, identity: 0.7 

ttgctatttttgttttaatctttagttccc	CRISPR spacer
gagctatttttgtcttgatctttagaggat	Protospacer
  ***********.**.********    .

76. spacer 1.8|80343|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to JQ680349 (Unidentified phage clone 1013_scaffold24 genomic sequence) position: , mismatch: 9, identity: 0.7 

atactgattaatctgaatggtttgagtgat	CRISPR spacer
caactgataactctgaatggtttgaagtgc	Protospacer
  ****** * **************.  ..

77. spacer 1.9|80409|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014002 (Synechococcus sp. PCC 73109 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7 

attgtttacaagctcccgaatataagcttg	CRISPR spacer
ttcccccccaagctcgcgaatataagcttc	Protospacer
 *. ... ******* *************

78. spacer 1.11|80541|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048285 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence) position: , mismatch: 9, identity: 0.71 

tttgatgactacgaattgcaagcagtgtata	CRISPR spacer
ggcggtgactgtgaattgcaagcagtgtcgc	Protospacer
  .*.*****..****************

79. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014149 (Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence) position: , mismatch: 9, identity: 0.71 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
catgagattttaaaagaatacttaaaaatgg	Protospacer
 **** * *****************     .

80. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015595 (Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tttttgtttttaaatgaatacttaatatata	Protospacer
  *     ****** *********** ****

81. spacer 1.12|80608|31|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to MN694024 (Marine virus AFVG_250M601, complete genome) position: , mismatch: 9, identity: 0.71 

aatgataatttaaaagaatacttaatttata	CRISPR spacer
tttgataatttaaaagaacatttaaaacttg	Protospacer
  ****************.*.****  . *.

82. spacer 1.13|80675|30|NC_010376|CRISPRCasFinder,CRT,PILER-CR matches to CP041751 (Bacillus paranthracis strain NCCP 14796 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

gagtaaaacataaaaagattgagtatgttg	CRISPR spacer
tcgtaaaaaataaaaagattgagggtaact	Protospacer
  ****** ************** .*. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 715050 : 723196 9 Planktothrix_phage(16.67%) NA NA
DBSCAN-SWA_2 773864 : 781926 9 Catovirus(33.33%) NA NA
DBSCAN-SWA_3 880237 : 891815 11 Bacillus_phage(25.0%) tRNA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage