Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013654 Escherichia coli SE15, complete genome 2 crisprs DinG,cas3,RT,DEDDh,c2c9_V-U4,csa3 0 1 4 0
NC_013655 Escherichia coli SE15 plasmid pECSF1, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. NC_013654
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013654_1 728607-728748 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013654_2 894815-894897 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12111-12158 8 0.833
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 424237-424284 8 0.833
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7391-7438 10 0.792
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84215-84262 10 0.792
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87125-87172 10 0.792
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229237-229284 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229338-229385 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229439-229486 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239731-239778 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239832-239879 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239933-239980 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15006-15053 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230643-230690 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230744-230791 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230845-230892 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211613-211660 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211714-211761 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211815-211862 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31250-31297 11 0.771
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3371-3418 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4012-4059 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4113-4160 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208980-209027 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3370-3417 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4011-4058 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4112-4159 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219474-219521 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3370-3417 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4011-4058 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4112-4159 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210308-210355 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3370-3417 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4011-4058 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4112-4159 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191263-191310 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 270-317 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 101195-101242 12 0.75
NC_013654_1 1.1|728654|48|NC_013654|CRISPRCasFinder 728654-728701 48 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 158-205 13 0.729

1. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.833

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gactcgtaggcctgataagacgcgccagcgtcgcatcaggcaccgaac	Protospacer
.* .********************* ****************   *.*

2. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 8, identity: 0.833

aaaccgtaggcctgataagacgcgcaagcgtcg-catcaggcaaacagc	CRISPR spacer
aacctgtaggcctgataagacgcgcaagcgtcgccatcaggcatctca-	Protospacer
** *.**************************** *********  . . 

3. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.792

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gttttgtaggcatgataagacgcgccagcgtcgcatcaggcatccggc	Protospacer
.  ..****** ************* ****************  *.**

4. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.792

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gttttgtaggcatgataagacgcgccagcgtcgcatcaggcatccggc	Protospacer
.  ..****** ************* ****************  *.**

5. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.792

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
attttgtaggcctgataagacgcggcagcgtcgcatcaggcatcgtgc	Protospacer
*  ..*******************  ****************    **

6. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

7. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

8. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgca	Protospacer
** ..*******************. ****************  ..  

9. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

10. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

11. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgca	Protospacer
** ..*******************. ****************  ..  

12. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctggt	Protospacer
.. .******* ************* ****************  ..*.

13. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

14. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

15. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgca	Protospacer
** ..*******************. ****************  ..  

16. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

17. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgcg	Protospacer
** ..*******************. ****************  ..  

18. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
aatttgtaggcctgataagacgcgttagcgtcgcatcaggcatctgca	Protospacer
** ..*******************. ****************  ..  

19. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 11, identity: 0.771

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
cggctgtaggcctgataagacgcgacagcgtcgcatcaggcattgatt	Protospacer
 ..*.*******************  ****************   * .

20. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. .******* ************* ****************  ..  

21. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

22. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

23. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

24. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. .******* ************* ****************  ..  

25. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

26. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

27. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

28. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. .******* ************* ****************  ..  

29. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

30. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

31. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

32. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcg	Protospacer
.. .******* ************* ****************  ..  

33. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgctagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

34. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtttgtaggcatgataagacgcgccagcgtcgcatcaggcatctgcg	Protospacer
*. ..****** ************* ****************  ..  

35. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
agtgggtaggcctgataagacgcgtcagcgtcgcatcaggcatctgag	Protospacer
*.   *******************. ****************  ... 

36. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
ggtttgtaggcctgataagacgcgacagcgtcgcatcaggcattgatt	Protospacer
.. ..*******************  ****************   * .

37. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.75

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
taatacaaggcctgataagacgcgccagcgtcgcatcaggcgctgaat	Protospacer
 **.   ****************** ***************.   *..

38. spacer 1.1|728654|48|NC_013654|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 13, identity: 0.729

aaaccgtaggcctgataagacgcgcaagcgtcgcatcaggcaaacagc	CRISPR spacer
gtctngtaggcctgataagacgcgtcagcgtcgcatcaggcttcaatt	Protospacer
.  . *******************. ***************    * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1137396 : 1190863 70 Enterobacteria_phage(55.17%) tail,lysis,portal,capsid,transposase,terminase,integrase,head,tRNA attL 1130032:1130047|attR 1194724:1194739
DBSCAN-SWA_2 2056139 : 2064810 8 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_3 2160848 : 2169160 9 Enterobacteria_phage(83.33%) NA NA
DBSCAN-SWA_4 2748332 : 2755472 6 Escherichia_phage(83.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_013655
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 33297 : 81061 40 Stx2-converting_phage(23.08%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage