1. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 1, identity: 0.955
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtgcc Protospacer
********************.*
2. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcgaagccggcggcagcg Protospacer
*******.**************
3. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH371116 (Mycobacterium phage DMoney, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
4. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH045569 (Mycobacterium phage Schiebel, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
5. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH371119 (Mycobacterium phage OctaviousRex, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
6. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
7. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH001456 (Mycobacterium phage CLED96, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
8. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to GQ303261 (Mycobacterium phage Hope, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
9. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MG099946 (Mycobacterium phage LouisV14, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
10. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcgcagccggcggcagcg Protospacer
******* **************
11. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787112 (Mycobacterium phage Clark, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
12. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779513 (Mycobacterium phage Olga, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
13. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK919475 (Mycobacterium phage Camri, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
14. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK310146 (Mycobacterium phage Crespo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
15. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK524493 (Mycobacterium phage Darionha, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
16. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779505 (Mycobacterium phage Grizzly, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
17. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to EU568876 (Mycobacterium phage BPs, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
18. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787107 (Mycobacterium phage Bo4, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
19. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
20. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KX588251 (Mycobacterium phage Jane, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
21. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787103 (Mycobacterium phage Chy2, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
22. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH001455 (Mycobacterium phage Remy19, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
23. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KP087941 (Eel River basin pequenovirus isolate c10494, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagccggcggctgcg Protospacer
****************** ***
24. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KT355472 (Mycobacterium phage Cedasite, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
25. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KX664455 (Mycobacterium phage Zombie, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
26. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH077584 (Mycobacterium phage Phish, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
27. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787108 (Mycobacterium phage DNAIII, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
28. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
29. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK433279 (Mycobacterium phage Kareem, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
30. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KJ725374 (Mycobacterium phage Guo1, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
31. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
32. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK305884 (Mycobacterium phage BQuat, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
33. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
34. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779515 (Mycobacterium phage Sweets, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
35. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MW119570 (Mycobacterium phage Lang, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
36. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787104 (Mycobacterium phage Chy3, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
37. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NC_012788 (Mycobacterium phage Angel, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
38. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KX443326 (Mycobacterium phage BruceB, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
39. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK433277 (Mycobacterium phage Renaissance, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
40. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH590605 (Mycobacterium phage Cherrybomb426, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
41. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779509 (Mycobacterium phage Kasen3, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
42. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to JN699002 (Mycobacterium phage Avrafan, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
43. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
44. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KT355474 (Mycobacterium phage Frosty24, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
45. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787109 (Mycobacterium phage Legendre, partial genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
46. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to JN412593 (Mycobacterium phage Liefie, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
47. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH479920 (Mycobacterium phage Mowgli, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
48. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NC_008202 (Mycobacterium phage Halo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
49. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KM923970 (Mycobacterium phage Gomashi, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
50. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH450127 (Mycobacterium phage Plagueis, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
51. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KT347314 (Mycobacterium phage Phreak, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
52. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KT365399 (Mycobacterium phage Annihilator, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
53. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to KC787110 (Mycobacterium phage Leo, complete genome) position: , mismatch: 1, identity: 0.955
gccggcggagccggcggcagcg CRISPR spacer
gccggcggcgccggcggcagcg Protospacer
******** *************
54. spacer 4.19|929626|27|NC_012207|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
55. spacer 4.19|929626|27|NC_012207|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
56. spacer 4.19|929626|27|NC_012207|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 2, identity: 0.926
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcgg Protospacer
** ******** ***************
57. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggcggtggg Protospacer
********************
58. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
agtcggcggtgccgacggtgtc Protospacer
*************.*******
59. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggcgtc Protospacer
.*****************.***
60. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgtcggcggtgtc Protospacer
.**********.**********
61. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP045122 (Rubrobacter sp. SCSIO 52915 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggcggcgtc Protospacer
*****************.***
62. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
63. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgtcggcggtgccggccgtgta Protospacer
**************** ****
64. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
ggtcggcggtgccggccgtgtc Protospacer
*************** *****
65. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 2, identity: 0.909
tgtcggcggtgccggcggtgtc CRISPR spacer
tgacggcggtgccggcggtgtg Protospacer
** ******************
66. spacer 5.15|1215354|22|NC_012207|CRISPRCasFinder matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 2, identity: 0.909
ggacggtggtaccggcggtcag CRISPR spacer
tgacggtggtgccggcggtcag Protospacer
*********.***********
67. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF919497 (Mycobacterium phage Chance64, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
68. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF668268 (Mycobacterium phage Aroostook, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
69. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MN444875 (Mycobacterium phage Jonghyun, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
70. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MT818422 (Mycobacterium phage Periodt, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
71. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MF668272 (Mycobacterium phage Gideon, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
72. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MH779507 (Mycobacterium phage Hotshotbaby7, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
73. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
74. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcggcg Protospacer
.*****************.***
75. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagccggcggcggct Protospacer
******************.**
76. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
77. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
78. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggagccggcggcatcg Protospacer
.****************** **
79. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
80. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
gccggcggagacggcggcagcc Protospacer
********** **********
81. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MK524494 (Mycobacterium phage Rabbs, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
82. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to NC_031102 (Mycobacterium phage Sneeze, complete genome) position: , mismatch: 2, identity: 0.909
gccggcggagccggcggcagcg CRISPR spacer
accggcggcgccggcggcagcg Protospacer
.******* *************
83. spacer 1.11|332581|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
84. spacer 1.11|332581|27|NC_012207|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 3, identity: 0.889
ccgccgttggcgaacagtccgccgttg CRISPR spacer
tcgccgttggcgatcagtccgccgtcg Protospacer
.************ ***********.*
85. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
86. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
87. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
88. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
89. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
90. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
91. spacer 4.18|929584|24|NC_012207|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
92. spacer 4.18|929584|24|NC_012207|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
93. spacer 4.18|929584|24|NC_012207|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
94. spacer 4.18|929584|24|NC_012207|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
95. spacer 4.18|929584|24|NC_012207|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
96. spacer 4.18|929584|24|NC_012207|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
97. spacer 4.18|929584|24|NC_012207|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
98. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
99. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
100. spacer 4.18|929584|24|NC_012207|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
101. spacer 4.19|929626|27|NC_012207|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgg Protospacer
**************** ********
102. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.889
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcggcaacggcta Protospacer
******************.****** .
103. spacer 4.19|929626|27|NC_012207|CRT matches to MN549360 (Rhizobium phage RL38J1, complete genome) position: , mismatch: 3, identity: 0.889
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgctgg-cggcaaaggcggtaacggcgg Protospacer
****. ****** **************
104. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to MN703413 (Arthrobacter phage Powerpuff, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
105. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to MT024871 (Arthrobacter phage YesChef, complete genome) position: , mismatch: 3, identity: 0.88
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgcgggcggcctcggcgtagcgctt Protospacer
*** *******************..
106. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
107. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
108. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
gtgcggcggtgccggcggtgtc Protospacer
*******************
109. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtgag Protospacer
.*******************
110. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
cgtcggcggtgccggcggtggt Protospacer
.******************* .
111. spacer 5.7|1214970|22|NC_012207|CRISPRCasFinder matches to KT381864 (Thiobacimonas phage vB_ThpS-P1, complete genome) position: , mismatch: 3, identity: 0.864
tgtcggcggtgccggcggtgtc CRISPR spacer
catcggcggtgccggcggtgtg Protospacer
..*******************
112. spacer 5.11|1215153|22|NC_012207|CRISPRCasFinder matches to NZ_CP048287 (Paenibacillus sp. 14171R-81 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.864
gctgtggggcggcggtggtgcc CRISPR spacer
cgtgtggggcggcggtggtgca Protospacer
*******************
113. spacer 6.5|2071445|24|NC_012207|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
114. spacer 6.5|2071445|24|NC_012207|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
115. spacer 10.1|4064404|22|NC_012207|CRISPRCasFinder matches to MN857473 (Teseptimavirus S2B, complete genome) position: , mismatch: 3, identity: 0.864
gccggcggagccggcggcagcg CRISPR spacer
cgaggcggagccggcggcagcg Protospacer
*******************
116. spacer 4.12|929299|27|NC_012207|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
117. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
118. spacer 4.12|929299|27|NC_012207|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
119. spacer 4.17|929536|30|NC_012207|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
120. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
121. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
122. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
123. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
124. spacer 4.18|929584|24|NC_012207|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
125. spacer 4.18|929584|24|NC_012207|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
126. spacer 4.18|929584|24|NC_012207|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
127. spacer 4.18|929584|24|NC_012207|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
128. spacer 4.18|929584|24|NC_012207|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
129. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
130. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
131. spacer 4.18|929584|24|NC_012207|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
132. spacer 4.18|929584|24|NC_012207|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
133. spacer 4.18|929584|24|NC_012207|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
134. spacer 4.18|929584|24|NC_012207|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
135. spacer 4.19|929626|27|NC_012207|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgg Protospacer
* .**********************
136. spacer 4.19|929626|27|NC_012207|CRT matches to MG198783 (Gordonia phage Mahdia, complete genome) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccagaccggcaacggcggtaacggcgt Protospacer
* **.********************
137. spacer 4.19|929626|27|NC_012207|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggccgg--ggcaacggcggtaacggcgg Protospacer
**.*. ********************
138. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggtgatcgtcaacggcggcaacggcga Protospacer
* ****** *********.*******.
139. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgctcggccacggcggtaacggctg Protospacer
*** ***** ************** *
140. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
141. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggtgacgacag Protospacer
******************.***.*.*
142. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 4, identity: 0.852
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgggaacaaccg Protospacer
****************** ***..* *
143. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852
--gctgatcggcaacggcggtaacggcgg CRISPR spacer
tagcgg--cggcaacggcggtagcggcgg Protospacer
** * **************.******
144. spacer 4.19|929626|27|NC_012207|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
145. spacer 4.19|929626|27|NC_012207|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.852
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgccgg-cggcaacggcggcaacggcgg Protospacer
**.*. ************.********
146. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
147. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggcggcctcggcggagcgctg Protospacer
**************** *****.
148. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
149. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to CP003956 (Rhodococcus opacus PD630 plasmid 7, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
gtccggcggccttggcgtagcgcct Protospacer
**********.***********.
150. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
151. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NC_012723 (Burkholderia glumae BGR1 plasmid bglu_1p, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggccccggcgtcgcgcga Protospacer
***********.****** ****
152. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtaatggtc Protospacer
*******************..* .*
153. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcatcggcgtagcggcg Protospacer
.********* *********** *
154. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggcctccgcgtcgcgcct Protospacer
.************ **** *****.
155. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcgggc Protospacer
.*.******************* *
156. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NC_022437 (Pseudomonas fluorescens R124 plasmid pMP-R124, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggcggccgcgtcgtagcgcca Protospacer
.********** ** *********
157. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
158. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggtgtcctcggcgtagcgcga Protospacer
******.* **************
159. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP051294 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077A, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
160. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
ggccggctgcctcggcatagcgccg Protospacer
****** ********.*******
161. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
162. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgccggtggcctcggcgtagccccg Protospacer
.*****.************** **
163. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP033363 (Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctccgcgaagcgctt Protospacer
************* *** *****..
164. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tggcggcggcctcgccgtagcgctt Protospacer
** *********** ********..
165. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
cgtcggcggcctcggcgtagcggac Protospacer
.*.******************* *
166. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
agccggcggcctcggcctcgcgccg Protospacer
*************** * *****
167. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 4, identity: 0.84
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgtcggcggcctcgccgtagcgctt Protospacer
**.*********** ********..
168. spacer 6.5|2071445|24|NC_012207|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
169. spacer 6.5|2071445|24|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
170. spacer 6.5|2071445|24|NC_012207|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
171. spacer 1.2|332101|27|NC_012207|CRT matches to MN103533 (Mycobacterium phage Weirdo19, complete genome) position: , mismatch: 5, identity: 0.815
ccggcgcctagagcgttggcaccgctg CRISPR spacer
ctcgggcctagagcgttggcaccgtgg Protospacer
*. * *******************. *
172. spacer 1.11|332581|27|NC_012207|CRT matches to MK415400 (Phage apr34_1784, complete genome) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
ccgccgttggcgaccagtccgcaatca Protospacer
************* ******** .*..
173. spacer 1.11|332581|27|NC_012207|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gggtcgtcggagaacagtccgccgttg Protospacer
*.***.** ****************
174. spacer 1.11|332581|27|NC_012207|CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 5, identity: 0.815
ccgccgttggcgaacagtccgccgttg CRISPR spacer
gtggcgttgtcgaacagaccgccgttg Protospacer
.* ***** ******* *********
175. spacer 1.12|332626|30|NC_012207|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggtcaccgccagcggggccagga Protospacer
********* ************ ***. *.
176. spacer 1.12|332626|30|NC_012207|CRT matches to KM389325 (UNVERIFIED: Pseudomonas phage F_ET2439sp/ET602 clone ctg7180000000169 genomic sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccgatccagacaccgccagcggcgccgagg Protospacer
***..* .******************* **
177. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
ccggccgggacaccgccagcggcg-ccgtgg CRISPR spacer
ccggccgggacaccgcccccggcgagcgcg- Protospacer
***************** ***** **.*
178. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
179. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
180. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP049701 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2b, complete sequence) position: , mismatch: 5, identity: 0.833
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
gcctggcc--gacagcgccagcggcgccgtgc Protospacer
*.**** **** ****************
181. spacer 4.5|929005|27|NC_012207|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
182. spacer 4.5|929005|27|NC_012207|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
183. spacer 4.5|929005|27|NC_012207|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
184. spacer 4.5|929005|27|NC_012207|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
185. spacer 4.5|929005|27|NC_012207|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 5, identity: 0.815
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttgccggtgggctgttcagcggcgg Protospacer
****************.******
186. spacer 4.8|929140|30|NC_012207|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcccggg Protospacer
******** * ************* ***
187. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.833
cggattcggcggattccgcggcggggaggg CRISPR spacer
cggattcgcccgattccgcggcggcacggg Protospacer
******** * ************* . ***
188. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
189. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
190. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
191. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
192. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
193. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
194. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
195. spacer 4.12|929299|27|NC_012207|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
196. spacer 4.12|929299|27|NC_012207|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
197. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
198. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
199. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
200. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
201. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
202. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
203. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
204. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
205. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
206. spacer 4.17|929536|30|NC_012207|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
207. spacer 4.18|929584|24|NC_012207|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
208. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggtaacgccgg Protospacer
.*.*. ***************** ***
209. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gttcttcggcaacggcggcaacggcgc Protospacer
*.* *************.*******
210. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
211. spacer 4.19|929626|27|NC_012207|CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggcgacaacggttt Protospacer
*****************..*****.
212. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
213. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
214. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tctgatcggcaacggcggcaacgacac Protospacer
*****************.****.*.
215. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
216. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
217. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
218. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
219. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
220. spacer 4.19|929626|27|NC_012207|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 5, identity: 0.815
gctgat--cggcaacggcggtaacggcgg CRISPR spacer
--cgacggcggcaatggcggtaacggcgg Protospacer
.**. ******.**************
221. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgaacggcaacggcggcaacgacac Protospacer
***** ************.****.*.
222. spacer 4.19|929626|27|NC_012207|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
223. spacer 4.19|929626|27|NC_012207|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
224. spacer 4.19|929626|27|NC_012207|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
225. spacer 4.19|929626|27|NC_012207|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
226. spacer 4.19|929626|27|NC_012207|CRT matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
227. spacer 4.19|929626|27|NC_012207|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
228. spacer 4.19|929626|27|NC_012207|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
229. spacer 4.19|929626|27|NC_012207|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
230. spacer 4.19|929626|27|NC_012207|CRT matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
231. spacer 4.19|929626|27|NC_012207|CRT matches to KF614509 (Rhizobium phage vB_RleS_L338C, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
232. spacer 4.19|929626|27|NC_012207|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
233. spacer 4.19|929626|27|NC_012207|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
234. spacer 4.19|929626|27|NC_012207|CRT matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
235. spacer 4.19|929626|27|NC_012207|CRT matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
236. spacer 4.19|929626|27|NC_012207|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
taccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
237. spacer 4.19|929626|27|NC_012207|CRT matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
238. spacer 4.19|929626|27|NC_012207|CRT matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 5, identity: 0.815
-gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccgg-cggcaacggcggcaacggcgg Protospacer
.*.*. ************.********
239. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
240. spacer 4.19|929626|27|NC_012207|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggtggcaacgactt Protospacer
***************.**.****.*
241. spacer 4.19|929626|27|NC_012207|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
242. spacer 4.19|929626|27|NC_012207|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
243. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
244. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggccacggcggcaacgacat Protospacer
********** *******.****.*.
245. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
246. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
247. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
248. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
249. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
250. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
251. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
252. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
253. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
254. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
255. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacggctgtgacgccac Protospacer
**************** **.*** *.
256. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgttcggcaacggcggcaacgatag Protospacer
**** *************.****...*
257. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
258. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tcggatcggcaaaggcggtcacggcga Protospacer
* ********* ****** ******.
259. spacer 4.19|929626|27|NC_012207|CRT matches to MT778840 (Rhizobium phage P11VFA, complete genome) position: , mismatch: 5, identity: 0.815
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcatcggcggttacgacaa Protospacer
*********** ******* ***.*..
260. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MG925349 (Mycobacterium phage Mendokysei, complete genome) position: , mismatch: 5, identity: 0.853
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggcgacggcgggttcccc Protospacer
******************** ******** *.
261. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
gcgcggcggcctcggcgtagagccg Protospacer
***************** ***
262. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NC_015178 (Acidiphilium multivorum AIU301 plasmid pACMV1, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
263. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
caccggcggcctcggcgtagcttgc Protospacer
..******************* . *
264. spacer 5.4|1214790|25|NC_012207|CRISPRCasFinder matches to NC_009469 (Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence) position: , mismatch: 5, identity: 0.8
tgccggcggcctcggcgtagcgccc CRISPR spacer
tgccggcggcctcggcgtggccgag Protospacer
******************.**
265. spacer 1.3|332146|30|NC_012207|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
tcagcggagccgaagatcacgccgccgagc Protospacer
.*.************* ** ******* *
266. spacer 1.12|332626|30|NC_012207|CRT matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccgggacaccggcatcggcgaaggcg Protospacer
*************** ** ***** * *
267. spacer 1.12|332626|30|NC_012207|CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 6, identity: 0.8
ccggccgggacaccgccagcggcgccgtgg---- CRISPR spacer
ccagccgggagaccgccagcggc----tggctct Protospacer
**.******* ************ ***
268. spacer 1.12|332626|30|NC_012207|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 6, identity: 0.8
--ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
agatggcc--gacaccaccagcggcgccgtgc Protospacer
.**** ******.**************
269. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
270. spacer 4.5|929005|27|NC_012207|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
gatggccggtaggctgttgaacggcgc Protospacer
.. *******.******* *******
271. spacer 4.5|929005|27|NC_012207|CRT matches to NC_023606 (Mycobacterium phage CRB1, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
272. spacer 4.5|929005|27|NC_012207|CRT matches to MK524491 (Mycobacterium phage Whabigail7, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
273. spacer 4.5|929005|27|NC_012207|CRT matches to KX619650 (Mycobacterium phage Jerm, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
274. spacer 4.5|929005|27|NC_012207|CRT matches to MN585998 (Mycobacterium phage Bugsy, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
275. spacer 4.5|929005|27|NC_012207|CRT matches to JN408460 (Mycobacterium phage Turbido, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
276. spacer 4.5|929005|27|NC_012207|CRT matches to MH077576 (Mycobacterium phage AbbyPaige, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
277. spacer 4.5|929005|27|NC_012207|CRT matches to MH825704 (Mycobacterium phage LilTurb, complete genome) position: , mismatch: 6, identity: 0.778
aggggccggtgggctgttcaacggcgg CRISPR spacer
ccttggcggtgggctgttcagcggcgg Protospacer
* **************.******
278. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
279. spacer 4.8|929140|30|NC_012207|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
280. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
281. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
282. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
283. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
284. spacer 4.8|929140|30|NC_012207|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
285. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
286. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgatgg Protospacer
.******************** ** **
287. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
288. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
289. spacer 4.8|929140|30|NC_012207|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
290. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
291. spacer 4.8|929140|30|NC_012207|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
gctgttcggcggattccgcggcggcgacgg Protospacer
.******************** ** **
292. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
293. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcggggtccg Protospacer
************ *********** *
294. spacer 4.12|929299|27|NC_012207|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
295. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
296. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
297. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
298. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
299. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
300. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
301. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
302. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
303. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
304. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
305. spacer 4.15|929440|30|NC_012207|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
306. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
307. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
308. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
309. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
310. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
311. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
312. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
313. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
314. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
315. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
316. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
317. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
318. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
319. spacer 4.15|929440|30|NC_012207|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
320. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
321. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
322. spacer 4.17|929536|30|NC_012207|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
323. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
324. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
325. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
326. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
327. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
328. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
329. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
330. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
331. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
332. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
333. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
334. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
335. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
336. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
337. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
338. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
339. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
340. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
341. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
342. spacer 4.17|929536|30|NC_012207|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
343. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
aacgggcggcaacggcggcaacggcgg Protospacer
. .*. ************.********
344. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccccggcggcaacggcggcaacggcgg Protospacer
*. . ************.********
345. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
acgcggcggcgacggcggtaacggcgg Protospacer
.* . ****.****************
346. spacer 4.19|929626|27|NC_012207|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
tgaaagcggcaacggcggtaacggcga Protospacer
.* ********************.
347. spacer 4.19|929626|27|NC_012207|CRT matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ccacgctggcaacggcggtaacggcgg Protospacer
* ...********************
348. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcgg Protospacer
* . . ************ ********
349. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
350. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggcaacggcgg Protospacer
* . ************.********
351. spacer 4.19|929626|27|NC_012207|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggccggcggcagcggcggtaacggcgg Protospacer
* . . *****.***************
352. spacer 4.19|929626|27|NC_012207|CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ggacgccggcaacggcggcaacggcgg Protospacer
* ..************.********
353. spacer 4.19|929626|27|NC_012207|CRT matches to MF919498 (Mycobacterium phage Cindaradix, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caccatcggcaacggcggtagcggtgg Protospacer
. ****************.***.**
354. spacer 4.19|929626|27|NC_012207|CRT matches to KR997929 (Mycobacterium phage Barriga, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
355. spacer 4.19|929626|27|NC_012207|CRT matches to MH576971 (Mycobacterium phage Arlo, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
356. spacer 4.19|929626|27|NC_012207|CRT matches to NC_028815 (Mycobacterium phage Nhonho, complete genome) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatgggcaacggcggcaacggcgg Protospacer
** ***********.********
357. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gagcggcggcaacggcggtaccggcgg Protospacer
* . ************** ******
358. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
359. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022417 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-2, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cggcatcggcaacggcggttgcggcgg Protospacer
*************** .******
360. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
gctgatcggcaacgccggcaacgatac Protospacer
************** ***.****...
361. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 6, identity: 0.778
gctgatcggcaacggcggtaacggcgg CRISPR spacer
actgagcggcaacggcggaaacggaat Protospacer
.**** ************ ***** .
362. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ggccggcggcaagggcggcgacggcggcgccggc-- Protospacer
************ ******* ***** * .***
363. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
caccggcggcaacggcggcggcggcggcttcggc-- Protospacer
.****************** ****** * ***
364. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
caccggcggcagcggcggcgccggcggcacggct- Protospacer
.*********.*************** ..****
365. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 6, identity: 0.824
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cggcggcggcaacggcggcgctggt-ggtggcaac Protospacer
* ******************.**. ****** *
366. spacer 10.2|4064451|36|NC_012207|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.833
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac Protospacer
*** *******************.**** .** **
367. spacer 10.2|4064451|36|NC_012207|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 6, identity: 0.833
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
cggcaacggcggggccggcgggccgctgaccgcgac Protospacer
*** *******************.**** .** **
368. spacer 1.3|332146|30|NC_012207|CRT matches to MK460246 (Mycobacterium phage Nibb, complete genome) position: , mismatch: 7, identity: 0.767
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
ccggcgaagccgaagcgcaagccgaaacgc Protospacer
******.******** ******** .. *
369. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcgcgaaca Protospacer
******.******** ********* . .
370. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ttggcccggtcaccgccagcggcgccgcca Protospacer
..**** ** *****************. .
371. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_AP022334 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49b, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
cgggccggaacaccgccagcggcgtgaggc Protospacer
* ******.***************. . *
372. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcctatgactccgccagcggcgccgtgc Protospacer
.** *.. *** *****************
373. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacaccga Protospacer
******.*************.**.* .*.
374. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
375. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
376. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
377. spacer 1.12|332626|30|NC_012207|CRT matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
acggccgggtcatcgccagcggcgaaccgg Protospacer
******** **.*********** .**
378. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
accgcatcgaccccgccagcggcgccgtga Protospacer
* ** *** *****************.
379. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
380. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccgccagcagcacgccga Protospacer
******.*************.**.* .*.
381. spacer 1.12|332626|30|NC_012207|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.767
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccatccggcacaccgccagcggcaccggca Protospacer
**. **** **************.*** .
382. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
383. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
384. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
385. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
386. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
387. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
388. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
389. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
390. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
391. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
392. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
393. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
394. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
395. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
396. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
397. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
398. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
399. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
aggattcggcggaggccgcggcgggatccg Protospacer
************ **********. *
400. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
cccgctgggcggattccgcgtcggggaagg Protospacer
* ..* ************* ******.**
401. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 7, identity: 0.767
cggattcggcggattccgcggcggggaggg CRISPR spacer
gggattcggtggattcagcggcggtggtgc Protospacer
********.****** ******* *. *
402. spacer 4.15|929440|30|NC_012207|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
403. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
404. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
405. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
406. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
407. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
408. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
409. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
410. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
411. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
412. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
413. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
414. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
415. spacer 4.15|929440|30|NC_012207|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
416. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
417. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
418. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
419. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
420. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
421. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
422. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
423. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
424. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
425. spacer 4.15|929440|30|NC_012207|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
426. spacer 4.15|929440|30|NC_012207|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
427. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
428. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
429. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
430. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
431. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
432. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
433. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
434. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
435. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
436. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
437. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
438. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
439. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
440. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
441. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
442. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
443. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
444. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
445. spacer 4.15|929440|30|NC_012207|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
446. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
447. spacer 4.15|929440|30|NC_012207|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
448. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
449. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
450. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
451. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
452. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
453. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
454. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
455. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
456. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
457. spacer 4.15|929440|30|NC_012207|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
458. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
459. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
460. spacer 4.15|929440|30|NC_012207|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
461. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
462. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
463. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
464. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
465. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
466. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
467. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
468. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
469. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
470. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
471. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
472. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
473. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
474. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
475. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
476. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
477. spacer 4.15|929440|30|NC_012207|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
478. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
479. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
480. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
481. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
482. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
483. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
484. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
485. spacer 4.15|929440|30|NC_012207|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
486. spacer 4.15|929440|30|NC_012207|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
487. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
488. spacer 4.15|929440|30|NC_012207|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
489. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
490. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
491. spacer 4.15|929440|30|NC_012207|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
492. spacer 4.15|929440|30|NC_012207|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
493. spacer 4.15|929440|30|NC_012207|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
494. spacer 4.15|929440|30|NC_012207|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
495. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
496. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
497. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
498. spacer 4.17|929536|30|NC_012207|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
499. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
500. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
501. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
502. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
503. spacer 4.17|929536|30|NC_012207|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
504. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
505. spacer 4.17|929536|30|NC_012207|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
506. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
507. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
508. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
509. spacer 4.17|929536|30|NC_012207|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
510. spacer 4.17|929536|30|NC_012207|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
511. spacer 4.17|929536|30|NC_012207|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
512. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
513. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
514. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
515. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
516. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
517. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cgcaggcggcaacggcggtagcggcgg Protospacer
... **************.******
518. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
519. spacer 4.19|929626|27|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
520. spacer 4.19|929626|27|NC_012207|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
atctggaggcaacggcggtaacggcgg Protospacer
... . ********************
521. spacer 4.19|929626|27|NC_012207|CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
522. spacer 4.19|929626|27|NC_012207|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
523. spacer 4.19|929626|27|NC_012207|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
524. spacer 4.19|929626|27|NC_012207|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
525. spacer 4.19|929626|27|NC_012207|CRT matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctcgatcagcaacggcggtaacggttt Protospacer
..****.****************.
526. spacer 4.19|929626|27|NC_012207|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
527. spacer 4.19|929626|27|NC_012207|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
528. spacer 4.19|929626|27|NC_012207|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
529. spacer 4.19|929626|27|NC_012207|CRT matches to MH669001 (Mycobacterium phage EleanorGeorge, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
cacccccggaaacggcggtaacggcgg Protospacer
. .*** *****************
530. spacer 4.19|929626|27|NC_012207|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
531. spacer 4.19|929626|27|NC_012207|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
532. spacer 4.19|929626|27|NC_012207|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ttccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
533. spacer 4.19|929626|27|NC_012207|CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
534. spacer 4.19|929626|27|NC_012207|CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
535. spacer 4.19|929626|27|NC_012207|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
536. spacer 4.19|929626|27|NC_012207|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
ctccggcggcaacggcggcaacggcgg Protospacer
.. . ************.********
537. spacer 4.19|929626|27|NC_012207|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 7, identity: 0.741
gctgatcggcaacggcggtaacggcgg CRISPR spacer
caacggcggcaacggcggcaacggcgg Protospacer
. ************.********
538. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
ggccggaggcaccggcggcgccggcggcacgggc- Protospacer
****** **** *************** ..** .
539. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
gaccggcggcagcggcggcgcgggcggagccggc-- Protospacer
*.*********.********* *****. .***
540. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
cgcaggcggcaacggcggccccggcggcgccgcc- Protospacer
** *************** ******* *. **.
541. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta---- CRISPR spacer
ggccgggggcaacggcggcgacggc----gtctacgac Protospacer
****** ************* **** * ***
542. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
543. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
tgccggcggcaacggcggcaacggcggcagcagc-- Protospacer
******************. ****** *..**
544. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg--tggcta CRISPR spacer
tgtcggcggcagcggcggcggcggcggggccggc-- Protospacer
*.********.******** ******* .***
545. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggt--ggcta CRISPR spacer
ggccggcggcatcggcgacgccggctgcttcagc-- Protospacer
*********** *****.******* * * .**
546. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
caccggcggccacggcggcaccggc-ggcggcgat Protospacer
.******** ********.***** **.*** *
547. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP039641 (Azospirillum sp. TSH100 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggcggcaccggcggcggcggcggtgaggcc- Protospacer
.* ******** ******** ****** * ***.
548. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH697583 (Mycobacterium phage EricMillard, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
549. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH727551 (Mycobacterium phage Kalah2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
550. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH077579 (Mycobacterium phage Halley, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
551. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH669017 (Mycobacterium phage Zelink, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
552. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN062701 (Mycobacterium phage Dallas, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
553. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK524527 (Mycobacterium phage ThreeRngTarjay, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
554. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK524529 (Mycobacterium phage Phoebus, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
555. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
556. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KF114875 (Mycobacterium phage Redno2, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
557. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK967379 (Mycobacterium phage HokkenD, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg---gtggcta CRISPR spacer
acccggcggcaacggcgcccccggcggcgtgtgg--- Protospacer
. *************** * ******* ****
558. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
agacggtggcagcggcggcgccggcggcggtgct- Protospacer
.* ***.****.*************** * ***
559. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcggg-tggcta CRISPR spacer
ggtcggcgccaacggcggcgccggtgaactgggt- Protospacer
**.***** ***************.*.. *** *
560. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
561. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
tggcggcggcaacggcggcggtggc-ggtggcggt Protospacer
* ***************** .*** ****** .
562. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggc--gggtggcta CRISPR spacer
cgctggcggcaacgtcggcgccggccatggcggc-- Protospacer
**.********** ********** **.***
563. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
tgctggcggcaacggcggcgtcggcatcgctggc-- Protospacer
**.****************.****. * ****
564. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 7, identity: 0.794
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
cgacggcggcaacggcggcggtggc-ggtggtcac Protospacer
* ***************** .*** *****..*
565. spacer 5.9|1215054|37|NC_012207|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 7, identity: 0.811
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
tgtcggcggtgccggcggtgccggcggtgccggcgac Protospacer
******************..******* . ***.**
566. spacer 6.3|2071355|30|NC_012207|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
567. spacer 6.3|2071355|30|NC_012207|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
568. spacer 6.3|2071355|30|NC_012207|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
569. spacer 10.2|4064451|36|NC_012207|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.806
cgggaacggcggggccggcgggctgctgttcggtac CRISPR spacer
gggcaacggcggggccggcgggccgctgaccgccac Protospacer
** *******************.**** .** .**
570. spacer 1.3|332146|30|NC_012207|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggcggagccgaagagcaagccgccgttc CRISPR spacer
agcacgaagccgaagagaaagccgccgatg Protospacer
.**.********** ********* *
571. spacer 1.12|332626|30|NC_012207|CRT matches to NC_019847 (Sinorhizobium meliloti GR4 plasmid pRmeGR4b, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcaccctggacaccgcctgcggcgccggac Protospacer
.*. ** ********** ********* .
572. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
ccggccaggacaccggcagcggcacgaaca Protospacer
******.******** *******.* . .
573. spacer 1.12|332626|30|NC_012207|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcggcgccgtgg CRISPR spacer
tcgcggtcgacaccgccagcggcgacgtga Protospacer
.** **************** ****.
574. spacer 1.12|332626|30|NC_012207|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
ccggccgggacaccgccagcg----gcgccgtgg CRISPR spacer
agggccgggacaccgcccgcggccagcgct---- Protospacer
*************** *** ****.
575. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
agttcgcggcggaatccgcggcggggaacg Protospacer
* . ******* *************. *
576. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.733
cggattcggcggattccgcggcggggaggg CRISPR spacer
gcccttcggcggatgccgcggcggcgagct Protospacer
********** ********* ***
577. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
578. spacer 4.15|929440|30|NC_012207|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
579. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
580. spacer 4.15|929440|30|NC_012207|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
581. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
582. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
583. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
584. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
585. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
586. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
587. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
588. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
589. spacer 4.15|929440|30|NC_012207|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
590. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
591. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
592. spacer 4.15|929440|30|NC_012207|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
593. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
594. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
595. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
596. spacer 4.17|929536|30|NC_012207|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
597. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
598. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
599. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
600. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
601. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
602. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
603. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
604. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
605. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
606. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
607. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
608. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
609. spacer 4.17|929536|30|NC_012207|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
610. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
611. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
612. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
613. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
614. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcgacggcggtcgcggt-- Protospacer
. ***************** ****** *.**.
615. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ccccggcggcaacggcggcaacggcggcaatgcc-- Protospacer
*****************. ****** .** *
616. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
cgccggcggcagcgccggcgccggcagtatcggc-- Protospacer
**********.** **********.* .***
617. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
tgtcggcggtaacggcggcgtcggcgg--agccagc Protospacer
*.******.**********.****** .**.*
618. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
619. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_047958 (Burkholderia phage vB_BmuP_KL4, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggccgcaacgacggcgccggcggccggtgc Protospacer
****** ******.************ .**.
620. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
621. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
622. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcgggaagggcggcgccggcggcggtctg Protospacer
******* ** ************** * **.
623. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
624. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacgtcggcgccggt-----gccaatgtt Protospacer
************** *********. **.*
625. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggaaacggtggcgccggcggcacggtg Protospacer
******** *****.*********** * *.
626. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
taccggcggcaatggaggcgccggcggcatcgcc- Protospacer
.**********.** *********** .* **.
627. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
628. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ctccggcggcaacggcggtgccgccgg--gaccact Protospacer
****************.**** *** *.*.*
629. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN234223 (Mycobacterium phage Philly, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
630. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KJ194581 (Mycobacterium phage Audrey, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
631. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH051265 (Mycobacterium phage Yahalom, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
632. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH316565 (Mycobacterium phage Mortcellus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
633. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT310871 (Mycobacterium phage Jackstina, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
634. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to EU816589 (Mycobacterium phage Phaedrus, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
635. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
636. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MG920059 (Mycobacterium phage Baloo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
637. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_023686 (Mycobacterium phage Gadjet, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
638. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_041965 (Mycobacterium phage Athena, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
639. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
640. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT310892 (Mycobacterium phage Compostia, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
641. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gtccggcggcaacggcggcgcgggcgcagcgcac Protospacer
* ******************* **** . **
642. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg----gtggcta CRISPR spacer
cggcggcggcaccggcggcaccggcggtgccgtg---- Protospacer
* ******** *******.******* ***
643. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta-- CRISPR spacer
ggccggcggcaacgggagcgccggc--ctcgccgcc Protospacer
*************** .******** * **..
644. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcg-gcaacggcggcgccggcgggtggcta CRISPR spacer
-ccgagcgcgccacggcggctccggcgggtggccc Protospacer
* .*** ** ******** ************.
645. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
646. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
647. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
648. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
649. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
650. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
651. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
652. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
653. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
654. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
655. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
656. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
657. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
658. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
659. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
660. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
661. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
662. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggccctggcggctcggtg Protospacer
.***************** *.***** * * *.
663. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ttccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
664. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
taccggcggcaacggcggcaacggcggcagcagc-- Protospacer
.*****************. ****** *..**
665. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN234184 (Mycobacterium phage IdentityCrisis, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caccggcggcagcggcggcgcaggcggaaacggc-- Protospacer
.*********.********* ***** ..***
666. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
667. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggcagcagc-- Protospacer
*****************. ****** *..**
668. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgg-gtggcta CRISPR spacer
tctcggcggcgacggcggcgacggcggtgttgat- Protospacer
.*******.********* ****** ** * *
669. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcaacggcggccgcggctgccagcca Protospacer
.****************** **** * ..**.*
670. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta- CRISPR spacer
gcgcggcggcaccggcggcaccggc-ggcggtcat Protospacer
* ******** *******.***** **.**..*
671. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN234183 (Mycobacterium phage Antsirabe, complete genome) position: , mismatch: 8, identity: 0.765
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggcagcggcggcggcggcggacgtcca Protospacer
*.********.******** ******..* *.*
672. spacer 5.9|1215054|37|NC_012207|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 8, identity: 0.784
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
agtcggcggcggcggcggcaccggcgggaccggcggc Protospacer
********.* **************** . ***..*
673. spacer 6.3|2071355|30|NC_012207|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
674. spacer 6.3|2071355|30|NC_012207|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
675. spacer 9.37|3068785|29|NC_012207|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
676. spacer 11.1|4064806|29|NC_012207|CRISPRCasFinder matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.724
aacggtggtaacgccggagttggcacgcc CRISPR spacer
tccgctggtaacgccggagatggcattgt Protospacer
** ************** *****. .
677. spacer 1.13|332674|39|NC_012207|CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
--ccgaagagcaaaccggcgtcgccgccgcgcccgccggcc CRISPR spacer
ggccggcgg--aaaccggcgtcgccgcggcggccgccggag Protospacer
***. *. **************** *** *******
678. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
679. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
680. spacer 3.1|693294|31|NC_012207|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
681. spacer 4.8|929140|30|NC_012207|CRT matches to NZ_CP021026 (Rhizobium sp. TAL182 plasmid pRetTAL182b, complete sequence) position: , mismatch: 9, identity: 0.7
cggattcggcggattccgcggcggggaggg CRISPR spacer
tggatccggtggattccgcggcggccgcat Protospacer
.****.***.************** . .
682. spacer 4.15|929440|30|NC_012207|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
683. spacer 4.17|929536|30|NC_012207|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
684. spacer 4.17|929536|30|NC_012207|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
685. spacer 4.19|929626|27|NC_012207|CRT matches to NC_017553 (Pantoea ananatis PA13 plasmid PAGR_p, complete sequence) position: , mismatch: 9, identity: 0.667
gctgatcggcaacggcggtaacggcgg--------- CRISPR spacer
---------caacggcggtaacggcggtaacggcgg Protospacer
******************
686. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgg--gtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcaacggc-- Protospacer
. ****************. ****** ..***
687. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcggcaacggcggccgcggcggcgacggc-- Protospacer
. **************** ***** *..***
688. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgccggcggcaactgcggcgccggcgcccaccgc Protospacer
************ ************ .. *
689. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
cagcggcagcaatggcggcgccggcggcgccggc-- Protospacer
. ****.****.************* * .***
690. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcgggaccggcggcgccggcggcagtatc Protospacer
* ****** * *************** * *
691. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
692. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
693. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcggcaacggcggtgccggtgcgccagcc Protospacer
******************.*****.* *. . .
694. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
695. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcggcattttc Protospacer
.********** ************** .*
696. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgtcggcggccacggcggcgtcggcggtcaggaa Protospacer
*.******* *********.****** ..* *
697. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcggcggcgggggcacc Protospacer
.********* ******** ******* * .
698. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KC170279 (Uncultured bacterium plasmid pMBUI8, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggcgccggcgtctaccag Protospacer
********** ************* *. * .
699. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
700. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaccggcggcgccgccggccatcat Protospacer
*.********* *********** *** .. *
701. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
702. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
703. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
704. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
705. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cggcggcggcaatggcggcaccggcggcacggtc Protospacer
* *********.******.******* * *
706. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
707. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
708. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcggcagcggtggtgga Protospacer
****************** *.**** * *
709. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
710. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
711. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
712. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
713. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
714. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
715. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
716. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
717. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
718. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
719. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
720. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
721. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
722. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggtggcaatggcggcgccggcggcgaggtc Protospacer
.****.*****.************** .* *
723. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH001451 (Mycobacterium phage Nairb, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
724. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MF155936 (Mycobacterium phage ZenTime222, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
725. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gaccggcggcaacggcggcggcggtggctcctcg Protospacer
*.****************** ***.** * ...
726. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK494089 (Mycobacterium phage Ibrahim, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
727. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_024135 (Mycobacterium phage Bernal13, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
728. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KM591905 (Mycobacterium phage RonRayGun, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
729. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN735432 (Mycobacteriophage Whitty, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaacggcggcaacggcggctatccc Protospacer
.*****************. ****** *. *.
730. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KX443399 (Rhodococcus hoagii strain PAM1354 plasmid pVAPA1354, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
731. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KX443400 (Rhodococcus hoagii strain PAM1557 plasmid pVAPN1557, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
732. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KX443398 (Rhodococcus hoagii strain PAM1204 plasmid pVAPN1204, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
733. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggccccggcggcgccggccagctgcac Protospacer
********* ************* .*. **
734. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KP851975 (Rhodococcus hoagii strain PAM2012 plasmid pVAPN2012, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
735. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
ctgcggcggcgacggcggcaccggcggaggcagc-- Protospacer
*******.********.****** **..**
736. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gttcggcggcgagggcggcgccggcggcaagcgt Protospacer
* .*******.* ************** .**
737. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KF439868 (Rhodococcus hoagii strain PAM1571 plasmid pVAPN1571, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta----- CRISPR spacer
ggccggcggcaacggaggggccgg-----agccacagga Protospacer
*************** ** ***** .**.*
738. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggcggcaacggcggccgcggcggctccgtg Protospacer
* **************** ****** * *.
739. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
740. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcgccggcggcgccggcggcgaggga Protospacer
* *******. *************** .* *
741. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
742. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
743. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_019789 (Deinococcus peraridilitoris DSM 19664 plasmid pDEIPE01, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caccggcggcaacggcggcaccgccgacaacggc-- Protospacer
.*****************.*** ** ...***
744. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
745. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
746. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
747. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
748. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
749. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
agccggcggcataggcggcgccggcagcatcctc Protospacer
.********** ************.* **
750. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
751. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcg--ggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcggcagc-- Protospacer
. ****************. ***** **..**
752. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
753. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggcaacggcggcttcccc Protospacer
*. ****************. ****** * *.
754. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacggccgcaacggcggctccggcggcgggaac Protospacer
* **** *********** ******* **
755. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
756. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.735
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccggcgaccacggcggcgccggtgcgctccat Protospacer
********.* *************.* *. *
757. spacer 5.9|1215054|37|NC_012207|CRISPRCasFinder matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 9, identity: 0.757
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
ggtgggcggtgccggcggcagcggcggcatggccttc Protospacer
** **************** ****** *.* * *
758. spacer 8.9|3066034|37|NC_012207|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757
tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga Protospacer
** . . ***.************* **********
759. spacer 8.10|3066107|37|NC_012207|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.757
tgcgtcaagtgcggcaccgccgtcatgtcggtgtcga CRISPR spacer
ggctgttgctgcagcaccgccgtcatctcggtgtcga Protospacer
** . . ***.************* **********
760. spacer 9.17|3069371|39|NC_012207|CRISPRCasFinder,CRT matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.769
tcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
agaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
761. spacer 4.2|928852|39|NC_012207|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
762. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcg-----ggtggcta CRISPR spacer
ccgcggcggcgacggcggcgcgggcggcaccggt----- Protospacer
*******.********** **** ***
763. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gagcggcggcaacggcggtaccggcggtgacgtc Protospacer
*. ***************..******* . *
764. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acccggcggcaccggcggcgcgggcggtccggcc Protospacer
. ********* ********* ***** . * .
765. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to CP000620 (Burkholderia vietnamiensis G4 plasmid pBVIE04, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgccggcggcatcggcgccgccggcgcggcatcg Protospacer
********** ***** ******** * ....
766. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaccggaggcgccggcggaggcacc Protospacer
********* *** ***********. * .
767. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
atccggcggcgccggcggcgccggcggcggaact Protospacer
. ********. *************** *. .
768. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
769. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MK494095 (Mycobacterium phage Daegal, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggcaccggcggcaccggcggcaccgga Protospacer
.********* *******.******* *
770. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
771. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ctccggcggcaacggcggcaacggcggctccacg Protospacer
*****************. ****** * ..
772. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP015373 (Pandoraea pnomenusa strain MCB032 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
773. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AP018709 (Uncultured bacterium plasmid pSN1104-59 DNA, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
774. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta------- CRISPR spacer
ggccgacggcaagggcggcgcc-------ggttacgcctcc Protospacer
*****.****** ********* **.**
775. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
776. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_008766 (Acidovorax sp. JS42 plasmid pAOVO02, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
777. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tgacggcggcaacagcggcaccggcggagcgaag Protospacer
* **********.*****.*******. * .
778. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
779. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP019238 (Rhodoferax koreense strain DCY-110 plasmid unnamed2) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
780. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcatcggcggcgcgggcgaggcccag Protospacer
********* ********* ****.* * .
781. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_021077 (Comamonas sp. 7D-2 plasmid pBHB, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
782. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_024998 (Acidovorax avenae subsp. avenae plasmid pAAA83 DNA, complete sequence, strain: 83) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
783. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_008385 (Burkholderia ambifaria AMMD plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
784. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
785. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_KJ588780 (Achromobacter xylosoxidans strain A22732 plasmid pA22732-IMP, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
786. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_MN366359 (Bacterium plasmid pALTS31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
787. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP027024 (Streptomyces sp. WAC00288 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcaacaacggcggcgccggcgccttcttc Protospacer
.*****..***************** * .*
788. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_001735 (Enterobacter aerogenes plasmid R751, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
789. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AGRM01000006 (Salmonella enterica subsp. houtenae str. ATCC BAA-1581 plasmid pSEHO0A1, complete sequence, whole genome shotgun sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
790. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AJ863570 (Uncultured bacterium IncP-1beta multiresistance plasmid pB8) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
791. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP034651 (Xanthomonas vasicola strain NCPPB 1060 plasmid pXVH45, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
792. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
793. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgtctgggccacggcggcgctggcgggtgggtg Protospacer
* . *** **********.********* *.
794. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
795. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JX469828 (Uncultured bacterium plasmid pRSB223, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
796. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JX469829 (Uncultured bacterium plasmid pB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tcccggcggcaagggcggtgccggcgtctatcag Protospacer
********** *****.******* *. * .
797. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JX469831 (Uncultured bacterium plasmid pKSP212, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
798. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106172 (Uncultured bacterium plasmid pAKD29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
799. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106173 (Uncultured bacterium plasmid pAKD31, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
800. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106174 (Uncultured bacterium plasmid pAKD33, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
801. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106164 (Uncultured bacterium plasmid pAKD1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
802. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106165 (Uncultured bacterium plasmid pAKD14, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
803. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106166 (Uncultured bacterium plasmid pAKD15, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
804. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106168 (Uncultured bacterium plasmid pAKD17, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
805. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JN106169 (Uncultured bacterium plasmid pAKD18, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
806. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
807. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_001381 (Mycobacterium fortuitum plasmid pAL5000, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
gcgcggcggcagcggcggcgctggcggcggcacg Protospacer
* ********.*********.***** * ..
808. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
809. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP021650 (Acidovorax sp. T1 plasmid p2-T1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
810. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to JX486125 (Uncultured bacterium plasmid pRWC72a, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
811. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP038640 (Cupriavidus oxalaticus strain X32 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
812. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to AJ639924 (Uncultured bacterium plasmid pB3 complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
813. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KU356987 (Variovorax paradoxus plasmid pBS64, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
814. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to KU356988 (Variovorax paradoxus plasmid pHB44, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
815. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcgacggcggcgacggcgccccgcgc Protospacer
********.********* ***** . **
816. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP009797 (Burkholderia ambifaria AMMD plasmid pBII_1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
817. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_013176 (Pseudomonas putida plasmid pW2, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
818. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_019320 (Variovorax sp. DB1 plasmid pDB1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
819. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP017455 (Dickeya solani strain PPO 9019 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
820. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NC_007337 (Cupriavidus pinatubonensis JMP134 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
821. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_MN366358 (Bacterium plasmid pALTS29, complete sequence) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ccccggcggcaagggcggtgccggcgtctaccag Protospacer
********** *****.******* *. * .
822. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MN234219 (Mycobacterium phage Mercurio, complete genome) position: , mismatch: 10, identity: 0.706
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cgacgtcggcaccggcggcgccggcggcgcgaag Protospacer
* ** ***** *************** * .
823. spacer 5.9|1215054|37|NC_012207|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
824. spacer 5.9|1215054|37|NC_012207|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.73
tgtcggcggtgccggcggcaccggcgggttaggcaac CRISPR spacer
cctcgacggtgccggcggcatcggcgggcgctggacc Protospacer
. ***.**************.*******. * * *
825. spacer 8.1|3065442|35|NC_012207|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
826. spacer 9.45|3069373|40|NC_012207|PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.75
ctcaaaaacggggacggcatgctgcatgccctaacgtcgt---- CRISPR spacer
gagaaaaacgaggacggcatgccgcatgcc----cgccgtccgc Protospacer
*******.***********.******* **.***
827. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caacggcggcaacggcggcaacggcggcacgtcg Protospacer
. ****************. ****** *...
828. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcagcggcggcggcggcggaaccccg Protospacer
.********.******** ******. *..
829. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MH051334 (Escherichia phage vB_EcoS-Ro145c2YLVW, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
830. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to MG852086 (Escherichia phage vB_EcoS-Ro145clw, complete genome) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
taccggcggctacggcggcggcggcggcaattgg Protospacer
.******** ********* ****** . . .
831. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caccggcggccacggcggggccggcggcgacgcg Protospacer
.******** ******* ******** . ..
832. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
tttcggcggcaagggcggcgccgccggcgatcag Protospacer
.********* ********** *** . * .
833. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
caggggcggcaacggcggccccggcaggacggcg Protospacer
. *************** *****.** * ..
834. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
cataggcggcgatggcggcgccggcgggatggcg Protospacer
.. ******.*.*************** * ..
835. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 11, identity: 0.676
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
ggccgacggcaagggcggcgccggatacgccccc Protospacer
*****.****** *********** . *.
836. spacer 5.5|1214838|40|NC_012207|CRISPRCasFinder matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.725
tgccggcggcgccggcggtgtcggcggacccgccgggttg CRISPR spacer
ggttggcggcaccggcggtgtcggcggagccggtgacatc Protospacer
*..******.***************** *** .*. *
837. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
aaccggcggcgacggcgtcgccggcgccaattcg Protospacer
..********.****** ******** . ...
838. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_CP026703 (Serratia marcescens strain AR_0027 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 12, identity: 0.647
ggccggcggcaacggcggcgc-----cggcgggtggcta CRISPR spacer
-gccggaaacgccggcgccgctgttgcggccggtg---- Protospacer
***** ..*. ***** *** **** ****
839. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 14, identity: 0.588
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccggcgtttccgccgaga----- Protospacer
***** ****. ***** . *** **.*
840. spacer 5.3|1214733|34|NC_012207|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 15, identity: 0.559
-----ggccggcggcaacggcggcgccggcgggtggcta CRISPR spacer
acggcggccgccggcgccgacgtttccgccgaga----- Protospacer
***** ****. **.** . *** **.*