Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_013799 Hydrogenobacter thermophilus TK-6, complete genome 1 crisprs csa3,TnpB_regular.1,cas3,DinG,Cas14u_CAS-V,cas2,cas1,cas4,cas5,cas7,cas8b1,cas6,DEDDh,Cas14b_CAS-V-F,cas14k 1 0 3 0

Results visualization

1. NC_013799
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_013799_1 1122544-1124919 TypeI-B NA
35 spacers
cas2,cas1,cas4,cas3,cas5,cas7,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_013799_1 1.27|1124318|37|NC_013799|CRISPRCasFinder,CRT,PILER-CR 1124318-1124354 37 NC_013799.1 568044-568080 0 1.0

1. spacer 1.27|1124318|37|NC_013799|CRISPRCasFinder,CRT,PILER-CR matches to position: 568044-568080, mismatch: 0, identity: 1.0

cataggcattgacgaaggggatatctactttaccgcc	CRISPR spacer
cataggcattgacgaaggggatatctactttaccgcc	Protospacer
*************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 773718 : 784872 8 Bacillus_phage(16.67%) tRNA NA
DBSCAN-SWA_2 1150735 : 1160162 9 uncultured_Caudovirales_phage(33.33%) NA NA
DBSCAN-SWA_3 1452973 : 1459162 8 Bacillus_virus(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage