Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_005364 Mycoplasma mycoides subsp. mycoides SC str. PG1 chromosome, complete genome 2 crisprs NA 0 2 9 0

Results visualization

1. NC_005364
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005364_1 990690-990826 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_005364_2 1005863-1005999 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KX550065 Streptococcus phage SpGS-1, complete genome 1780-1813 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KT337348 Streptococcus phage phiARI0378, partial genome 35768-35801 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KY065487 Streptococcus phage IPP48, complete genome 1573-1606 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 AJ400629 Streptococcus pneumoniae bacteriophage MM1 attachment site attP 78-111 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KT337358 Streptococcus phage phiARI0468-4, complete genome 35716-35749 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KT337347 Streptococcus phage phiARI0285-3, partial genome 37766-37799 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 KY065491 Streptococcus phage IPP53, complete genome 1572-1605 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 DQ113772 Streptococcus pneumoniae bacteriophage MM1 1998, complete genome 1660-1693 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 AJ302074 Streptococcus pneumoniae bacteriophage MM1 complete genome 1660-1693 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 NC_022791 Streptococcus phage phiBHN167 complete genome 30134-30167 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KX550065 Streptococcus phage SpGS-1, complete genome 1780-1813 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KT337348 Streptococcus phage phiARI0378, partial genome 35768-35801 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KY065487 Streptococcus phage IPP48, complete genome 1573-1606 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 AJ400629 Streptococcus pneumoniae bacteriophage MM1 attachment site attP 78-111 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KT337358 Streptococcus phage phiARI0468-4, complete genome 35716-35749 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KT337347 Streptococcus phage phiARI0285-3, partial genome 37766-37799 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 KY065491 Streptococcus phage IPP53, complete genome 1572-1605 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 DQ113772 Streptococcus pneumoniae bacteriophage MM1 1998, complete genome 1660-1693 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 AJ302074 Streptococcus pneumoniae bacteriophage MM1 complete genome 1660-1693 7 0.794
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 NC_022791 Streptococcus phage phiBHN167 complete genome 30134-30167 7 0.794
NC_005364_1 1.1|990713|34|NC_005364|PILER-CR 990713-990746 34 NZ_CP009064 Borreliella afzelii K78 plasmid lp28-3, complete sequence 3129-3162 10 0.706
NC_005364_2 2.1|1005886|34|NC_005364|PILER-CR 1005886-1005919 34 NZ_CP009064 Borreliella afzelii K78 plasmid lp28-3, complete sequence 3129-3162 10 0.706

1. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KX550065 (Streptococcus phage SpGS-1, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

2. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KT337348 (Streptococcus phage phiARI0378, partial genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

3. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KY065487 (Streptococcus phage IPP48, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

4. spacer 1.1|990713|34|NC_005364|PILER-CR matches to AJ400629 (Streptococcus pneumoniae bacteriophage MM1 attachment site attP) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

5. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KT337358 (Streptococcus phage phiARI0468-4, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

6. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KT337347 (Streptococcus phage phiARI0285-3, partial genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

7. spacer 1.1|990713|34|NC_005364|PILER-CR matches to KY065491 (Streptococcus phage IPP53, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

8. spacer 1.1|990713|34|NC_005364|PILER-CR matches to DQ113772 (Streptococcus pneumoniae bacteriophage MM1 1998, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

9. spacer 1.1|990713|34|NC_005364|PILER-CR matches to AJ302074 (Streptococcus pneumoniae bacteriophage MM1 complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

10. spacer 1.1|990713|34|NC_005364|PILER-CR matches to NC_022791 (Streptococcus phage phiBHN167 complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

11. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KX550065 (Streptococcus phage SpGS-1, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

12. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KT337348 (Streptococcus phage phiARI0378, partial genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

13. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KY065487 (Streptococcus phage IPP48, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

14. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to AJ400629 (Streptococcus pneumoniae bacteriophage MM1 attachment site attP) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

15. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KT337358 (Streptococcus phage phiARI0468-4, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

16. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KT337347 (Streptococcus phage phiARI0285-3, partial genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

17. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to KY065491 (Streptococcus phage IPP53, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

18. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to DQ113772 (Streptococcus pneumoniae bacteriophage MM1 1998, complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

19. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to AJ302074 (Streptococcus pneumoniae bacteriophage MM1 complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

20. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to NC_022791 (Streptococcus phage phiBHN167 complete genome) position: , mismatch: 7, identity: 0.794

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
caacaaaaataacaattatgataatagcaattat	Protospacer
.****************** ***** .  *.***

21. spacer 1.1|990713|34|NC_005364|PILER-CR matches to NZ_CP009064 (Borreliella afzelii K78 plasmid lp28-3, complete sequence) position: , mismatch: 10, identity: 0.706

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
aaacaagactaacaattatcataatataaaaaac	Protospacer
 *****.* ****************  . *  *.

22. spacer 2.1|1005886|34|NC_005364|PILER-CR matches to NZ_CP009064 (Borreliella afzelii K78 plasmid lp28-3, complete sequence) position: , mismatch: 10, identity: 0.706

taacaaaaataacaattatcataatcagtactat	CRISPR spacer
aaacaagactaacaattatcataatataaaaaac	Protospacer
 *****.* ****************  . *  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17077 : 71267 49 Bacillus_phage(15.38%) transposase,tRNA NA
DBSCAN-SWA_2 88757 : 162290 60 Bacillus_phage(23.08%) transposase,tRNA NA
DBSCAN-SWA_3 200976 : 266533 58 Bacillus_phage(11.76%) transposase,tRNA NA
DBSCAN-SWA_4 643445 : 723280 59 Bodo_saltans_virus(22.22%) transposase,tRNA,protease NA
DBSCAN-SWA_5 756755 : 801234 34 Bacillus_phage(50.0%) transposase,tRNA NA
DBSCAN-SWA_6 856212 : 914053 46 Planktothrix_phage(40.0%) transposase,tRNA NA
DBSCAN-SWA_7 922862 : 993531 55 Bacillus_phage(15.38%) transposase NA
DBSCAN-SWA_8 998604 : 1061119 56 Bacillus_phage(28.57%) transposase NA
DBSCAN-SWA_9 1082968 : 1156758 55 Mycoplasma_phage(25.0%) transposase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage