Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_017382 Helicobacter pylori 51, complete genome 1 crisprs RT,DEDDh 0 1 0 0

Results visualization

1. NC_017382
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_017382_1 934028-934221 Orphan NA:I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_017382_1 1.5|934168|33|NC_017382|CRT 934168-934200 33 MN034290 Leviviridae sp. isolate H4_Bulk_Litter_23_scaffold_319_e_1256 hypothetical protein (H4BulkL23319e1256_000001) gene, partial cds; and hypothetical protein (H4BulkL23319e1256_000002) and RNA-dependent RNA polymerase (H4BulkL23319e1256_000003) genes, complete cds 290-322 9 0.727

1. spacer 1.5|934168|33|NC_017382|CRT matches to MN034290 (Leviviridae sp. isolate H4_Bulk_Litter_23_scaffold_319_e_1256 hypothetical protein (H4BulkL23319e1256_000001) gene, partial cds; and hypothetical protein (H4BulkL23319e1256_000002) and RNA-dependent RNA polymerase (H4BulkL23319e1256_000003) genes, complete cds) position: , mismatch: 9, identity: 0.727

ttttactgacaacgccagcttcaataacgatac	CRISPR spacer
ctttactgaaaacgccagcatcaataccagcct	Protospacer
.******** ********* ****** *... .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage