Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007204 Psychrobacter arcticus 273-4, complete sequence 2 crisprs RT,DEDDh,csa3,WYL,cas3 0 1 5 0

Results visualization

1. NC_007204
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007204_1 226421-226495 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007204_2 1179131-1179216 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN657043 Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence 2453-2479 4 0.852
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN657043 Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence 2504-2530 4 0.852
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN657043 Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence 2351-2377 5 0.815
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN657043 Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence 2402-2428 5 0.815
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN657043 Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence 2300-2326 6 0.778
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 MN694403 Marine virus AFVG_250M373, complete genome 22006-22032 7 0.741
NC_007204_1 1.1|226445|27|NC_007204|CRISPRCasFinder 226445-226471 27 CAJCJZ010000002 Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence 52504-52530 7 0.741

1. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN657043 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence) position: , mismatch: 4, identity: 0.852

tcgagtcatatctaattttcctgagtc	CRISPR spacer
ccgagtcatatctaattttgctgaagc	Protospacer
.****************** ****. *

2. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN657043 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence) position: , mismatch: 4, identity: 0.852

tcgagtcatatctaattttcctgagtc	CRISPR spacer
tcgagtcatatctaactttgctgaagc	Protospacer
***************.*** ****. *

3. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN657043 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence) position: , mismatch: 5, identity: 0.815

tcgagtcatatctaattttcctgagtc	CRISPR spacer
ccgagtcatatctgattttgctgaagc	Protospacer
.************.***** ****. *

4. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN657043 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence) position: , mismatch: 5, identity: 0.815

tcgagtcatatctaattttcctgagtc	CRISPR spacer
ccgagtcatatctgattttgctgaagc	Protospacer
.************.***** ****. *

5. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN657043 (Psychrobacter sp. strain ANT_P18B plasmid pA18BP2, complete sequence) position: , mismatch: 6, identity: 0.778

tcgagtcatatctaattttcctgagtc	CRISPR spacer
tcgagtcatatctgattttgctggact	Protospacer
*************.***** ***....

6. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to MN694403 (Marine virus AFVG_250M373, complete genome) position: , mismatch: 7, identity: 0.741

tcgagtcatatctaattttcctgagtc	CRISPR spacer
catagtcatatctaattttccttcctt	Protospacer
.  *******************   *.

7. spacer 1.1|226445|27|NC_007204|CRISPRCasFinder matches to CAJCJZ010000002 (Enterococcus phage vB_EfaS_140 genome assembly, contig: phage140-genome, whole genome shotgun sequence) position: , mismatch: 7, identity: 0.741

tcgagtcatatctaattttcctgagtc	CRISPR spacer
tccagtcatatctaattttccatcacg	Protospacer
** ******************   .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 401245 : 410876 7 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_2 482732 : 588985 93 Psychrobacter_phage(19.44%) terminase,protease,capsid,head,portal,integrase,transposase,tail,holin,tRNA attL 550056:550083|attR 585388:585415
DBSCAN-SWA_3 771889 : 780270 7 Tupanvirus(28.57%) NA NA
DBSCAN-SWA_4 1177956 : 1188903 19 Moraxella_phage(44.44%) NA NA
DBSCAN-SWA_5 1191905 : 1198297 7 Pseudomonas_phage(33.33%) capsid,terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage