Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_003910 Colwellia psychrerythraea 34H, complete sequence 5 crisprs csa3,cas3,DEDDh,DinG,WYL 2 0 0 0

Results visualization

1. NC_003910
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003910_1 367913-368028 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003910_2 760246-760401 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003910_3 889750-889865 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003910_4 3874152-3874225 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_003910_5 3967485-3968398 Orphan NA
14 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_003910_1 1.1|367941|60|NC_003910|CRISPRCasFinder 367941-368000 60 NC_003910.7 367897-367956 0 1.0
NC_003910_1 1.1|367941|60|NC_003910|CRISPRCasFinder 367941-368000 60 NC_003910.7 889734-889793 0 1.0
NC_003910_3 3.1|889778|60|NC_003910|CRISPRCasFinder 889778-889837 60 NC_003910.7 367897-367956 0 1.0
NC_003910_3 3.1|889778|60|NC_003910|CRISPRCasFinder 889778-889837 60 NC_003910.7 889734-889793 0 1.0

1. spacer 1.1|367941|60|NC_003910|CRISPRCasFinder matches to position: 367897-367956, mismatch: 0, identity: 1.0

gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	CRISPR spacer
gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	Protospacer
************************************************************

2. spacer 1.1|367941|60|NC_003910|CRISPRCasFinder matches to position: 889734-889793, mismatch: 0, identity: 1.0

gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	CRISPR spacer
gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	Protospacer
************************************************************

3. spacer 3.1|889778|60|NC_003910|CRISPRCasFinder matches to position: 367897-367956, mismatch: 0, identity: 1.0

gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	CRISPR spacer
gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	Protospacer
************************************************************

4. spacer 3.1|889778|60|NC_003910|CRISPRCasFinder matches to position: 889734-889793, mismatch: 0, identity: 1.0

gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	CRISPR spacer
gttatcctggcaagcgtgcctggacaatgaattagtaccaaaaagttatcctggcaagcg	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage