Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007484 Nitrosococcus oceani ATCC 19707, complete sequence 1 crisprs c2c9_V-U4,cas14j,DEDDh,WYL,c2c10_CAS-V-U3,DinG,cas3,Cas14u_CAS-V,cas3f,cas1,cas8f,cas5f,cas7f,cas6f 0 4 8 0
NC_007483 Nitrosococcus oceani ATCC 19707 plasmid A, complete sequence 0 crisprs NA 0 0 5 0

Results visualization

1. NC_007484
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007484_1 3128058-3128445 TypeV,TypeI-F I-F
6 spacers
cas6f,cas7f,cas5f,cas8f,cas1,cas3f,cas14j

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007484_1 1.1|3128086|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128086-3128117 32 NZ_CP009218 Rickettsiales bacterium Ac37b plasmid 1, complete sequence 37684-37715 4 0.875
NC_007484_1 1.4|3128266|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128266-3128297 32 JX195166 Pectobacterium phage My1, complete genome 34861-34892 7 0.781
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP045274 Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence 15323-15354 7 0.781
NC_007484_1 1.3|3128206|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128206-3128237 32 NZ_AP018256 Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome 310962-310993 8 0.75
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 166690-166721 9 0.719
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 524080-524111 9 0.719
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 287364-287395 9 0.719
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 287404-287435 9 0.719
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 274430-274461 9 0.719
NC_007484_1 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT 3128386-3128417 32 MN497415 Vibrio phage vB_VhaM_VH-8, complete genome 6918-6949 10 0.688

1. spacer 1.1|3128086|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009218 (Rickettsiales bacterium Ac37b plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.875

-taccaagtacatcaatatctctggagttattt	CRISPR spacer
ctaccaaa-acatcaatatctcttgagttcttt	Protospacer
 ******. ************** ***** ***

2. spacer 1.4|3128266|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to JX195166 (Pectobacterium phage My1, complete genome) position: , mismatch: 7, identity: 0.781

acctact-caccaaagattggggtttatctatc	CRISPR spacer
-ccgaccgcaccaaacattggggtttagctaat	Protospacer
 ** **. ******* *********** *** .

3. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 7, identity: 0.781

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
cttataaaattttattagtgagaaaagaaaat	Protospacer
 .******* ** **************...**

4. spacer 1.3|3128206|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018256 (Calothrix sp. NIES-4071 plasmid plasmid1 DNA, complete genome) position: , mismatch: 8, identity: 0.75

----aatttaaaaagaacagaagtcccgtgttatcg	CRISPR spacer
ttccagtt----aagaaccgaattcccgtgttatca	Protospacer
    *.**    ****** *** ************.

5. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 9, identity: 0.719

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
agtataaaagataattagtgagtaaatatttt	Protospacer
. ******** *********** *** .   *

6. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 9, identity: 0.719

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
agtataaaagataattagtgagtaaatatttt	Protospacer
. ******** *********** *** .   *

7. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 9, identity: 0.719

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
agtataaaagataattagtgagtaaatatttt	Protospacer
. ******** *********** *** .   *

8. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 9, identity: 0.719

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
agtataaaagataattagtgagtaaatatttt	Protospacer
. ******** *********** *** .   *

9. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 9, identity: 0.719

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
agtataaaagataattagtgagtaaatatttt	Protospacer
. ******** *********** *** .   *

10. spacer 1.6|3128386|32|NC_007484|PILER-CR,CRISPRCasFinder,CRT matches to MN497415 (Vibrio phage vB_VhaM_VH-8, complete genome) position: , mismatch: 10, identity: 0.688

gctataaaagttaattagtgagaaaaggggat	CRISPR spacer
tatataaaagttaattagtaagcaattcagta	Protospacer
  *****************.** **   .*  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6934 : 52706 46 Moraxella_phage(16.67%) tRNA,transposase,integrase,terminase attL 6054:6068|attR 48140:48154
DBSCAN-SWA_2 408396 : 446892 34 Geobacillus_virus(16.67%) transposase,tRNA,protease NA
DBSCAN-SWA_3 843444 : 851565 7 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_4 1664389 : 1721534 49 Thermobifida_phage(16.67%) transposase,protease NA
DBSCAN-SWA_5 1740220 : 1777998 39 Saccharomonospora_phage(33.33%) transposase,integrase,holin,protease,tRNA attL 1739252:1739271|attR 1773895:1773914
DBSCAN-SWA_6 2114575 : 2143516 23 Synechococcus_phage(25.0%) tail,transposase,plate NA
DBSCAN-SWA_7 2329571 : 2339987 8 Tupanvirus(14.29%) NA NA
DBSCAN-SWA_8 2527672 : 2587936 55 Virus_Rctr71(28.57%) portal,transposase,integrase,protease attL 2527109:2527126|attR 2588714:2588731
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007483
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1080 1 Pectobacterium_phage(100.0%) NA NA
DBSCAN-SWA_2 9855 : 18974 9 Brevibacillus_phage(20.0%) integrase attL 10229:10243|attR 23681:23695
DBSCAN-SWA_3 24007 : 26758 1 Leptospira_phage(100.0%) NA NA
DBSCAN-SWA_4 30792 : 31803 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 39091 : 39592 1 Lactobacillus_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage