Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009615 Parabacteroides distasonis ATCC 8503, complete sequence 2 crisprs PrimPol,cas3,DEDDh,cas5,cas8c,cas7,cas4,cas1,cas2,PD-DExK,csa3 0 2 2 0

Results visualization

1. NC_009615
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009615_1 1380418-1380710 TypeI I-C
4 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009615_2 2348549-2348651 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 FR714877 Flavobacterium phage FL-1 DNA for ORF1 and ORF2 600-632 7 0.788
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 KY421186 Flavobacterium phage FL-1, complete genome 49789-49821 7 0.788
NC_009615_1 1.1|1380450|34|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380450-1380483 34 NC_015693 Runella slithyformis DSM 19594 plasmid pRUNSL01, complete sequence 85594-85627 9 0.735
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 NZ_CP038614 Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence 139472-139504 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP019696 Shigella sonnei strain 75/02 plasmid pInv_75_02_1, complete sequence 71939-71971 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP053752 Shigella sonnei strain 506 plasmid pMHMC-001, complete sequence 7429-7461 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP010830 Shigella sonnei strain FORC_011 plasmid pFORC11.1, complete sequence 71943-71975 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP046285 Shigella sonnei strain FDAARGOS_715 plasmid unnamed1, complete sequence 45606-45638 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP000039 Shigella sonnei Ss046 plasmid pSS_046, complete sequence 197807-197839 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 HE616529 Shigella sonnei 53G plasmid A, complete genome 199185-199217 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 CP023646 Shigella sonnei strain CFSAN030807 plasmid pCFSAN030807_1, complete sequence 32022-32054 9 0.727
NC_009615_1 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT 1380516-1380548 33 MN694164 Marine virus AFVG_250M1189, complete genome 50878-50910 9 0.727

1. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to FR714877 (Flavobacterium phage FL-1 DNA for ORF1 and ORF2) position: , mismatch: 7, identity: 0.788

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ttttcatgatattagtttttaagattattgtta	Protospacer
** .****************** .*****  * 

2. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to KY421186 (Flavobacterium phage FL-1, complete genome) position: , mismatch: 7, identity: 0.788

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ttttcatgatattagtttttaagattattgtta	Protospacer
** .****************** .*****  * 

3. spacer 1.1|1380450|34|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to NC_015693 (Runella slithyformis DSM 19594 plasmid pRUNSL01, complete sequence) position: , mismatch: 9, identity: 0.735

caatgtcttcggggtatattccttgccttgatag----	CRISPR spacer
caatgtcttcggggtatttttct----ttgacgcgttc	Protospacer
***************** **.**    ****..     

4. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038614 (Arsenophonus nasoniae strain FIN plasmid pArsFIN2, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
tcttaattatattagtttttaatgatattctgt	Protospacer
*. . ** **************** ****.  *

5. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP019696 (Shigella sonnei strain 75/02 plasmid pInv_75_02_1, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

6. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP053752 (Shigella sonnei strain 506 plasmid pMHMC-001, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

7. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP010830 (Shigella sonnei strain FORC_011 plasmid pFORC11.1, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

8. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP046285 (Shigella sonnei strain FDAARGOS_715 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

9. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP000039 (Shigella sonnei Ss046 plasmid pSS_046, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

10. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to HE616529 (Shigella sonnei 53G plasmid A, complete genome) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

11. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to CP023646 (Shigella sonnei strain CFSAN030807 plasmid pCFSAN030807_1, complete sequence) position: , mismatch: 9, identity: 0.727

ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
ccggtctaataatagtgtttaatgttatttata	Protospacer
..* . *.*** **** *************** 

12. spacer 1.2|1380516|33|NC_009615|PILER-CR,CRISPRCasFinder,CRT matches to MN694164 (Marine virus AFVG_250M1189, complete genome) position: , mismatch: 9, identity: 0.727

-------ttgccatgatattagtttttaatgttatttatt	CRISPR spacer
aaaaatctt-------tattattttttaatgttctttatt	Protospacer
       **       ***** *********** ******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 767617 : 776662 8 Synechococcus_phage(42.86%) NA NA
DBSCAN-SWA_2 999093 : 1006646 9 uncultured_Mediterranean_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage