Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007776 Synechococcus sp. JA-2-3B'a(2-13), complete sequence 11 crisprs Cas14u_CAS-V,c2c9_V-U4,cas14i,cas1,csm6,csx21,csm3gr7,csx19,PD-DExK,csm2gr11,csx10gr5,cas10,cas6,WYL,csx3,cas2,csx18,cmr5gr11,cmr4gr7,cmr3gr5,csx1,Cas14c_CAS-V-F,csa3,DEDDh,DinG,cas14j,cas3 2 1 4 0

Results visualization

1. NC_007776
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_1 156523-159258 Orphan NA
36 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_2 269406-269476 Unclear NA
1 spacers
c2c9_V-U4,Cas14u_CAS-V

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_3 515271-516591 TypeV NA
17 spacers
cas14i

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_4 604640-605267 TypeIII NA
8 spacers
cas6,cas10,csm3gr7,csx10gr5,csm2gr11,PD-DExK,csx19,Cas14u_CAS-V,WYL,csx3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_5 866037-867185 TypeIII NA
15 spacers
cas2,cas1,csx18,csm3gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,csx1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_6 880253-880429 TypeIII NA
2 spacers
csx1,cas10,cmr3gr5,cmr4gr7,cmr5gr11,csm3gr7,csx18

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_7 1058811-1058883 Unclear NA
1 spacers
Cas14u_CAS-V

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_8 1427989-1429246 Orphan NA
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_9 2016367-2018657 Orphan NA
30 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_10 2188864-2188940 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007776_11 2474054-2474157 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_007776_2 2.1|269429|25|NC_007776|CRISPRCasFinder 269429-269453 25 NC_007776.1 1245060-1245084 0 1.0
NC_007776_2 2.1|269429|25|NC_007776|CRISPRCasFinder 269429-269453 25 NC_007776.1 2506791-2506815 0 1.0
NC_007776_2 2.1|269429|25|NC_007776|CRISPRCasFinder 269429-269453 25 NC_007776.1 2507031-2507055 0 1.0
NC_007776_1 1.1|156559|37|NC_007776|CRT 156559-156595 37 NC_007776.1 2016330-2016366 2 0.946
NC_007776_2 2.1|269429|25|NC_007776|CRISPRCasFinder 269429-269453 25 NC_007776.1 1663884-1663908 2 0.92

1. spacer 2.1|269429|25|NC_007776|CRISPRCasFinder matches to position: 1245060-1245084, mismatch: 0, identity: 1.0

tgtcgctacgcgacgctaacgcgaa	CRISPR spacer
tgtcgctacgcgacgctaacgcgaa	Protospacer
*************************

2. spacer 2.1|269429|25|NC_007776|CRISPRCasFinder matches to position: 2506791-2506815, mismatch: 0, identity: 1.0

tgtcgctacgcgacgctaacgcgaa	CRISPR spacer
tgtcgctacgcgacgctaacgcgaa	Protospacer
*************************

3. spacer 2.1|269429|25|NC_007776|CRISPRCasFinder matches to position: 2507031-2507055, mismatch: 0, identity: 1.0

tgtcgctacgcgacgctaacgcgaa	CRISPR spacer
tgtcgctacgcgacgctaacgcgaa	Protospacer
*************************

4. spacer 1.1|156559|37|NC_007776|CRT matches to position: 2016330-2016366, mismatch: 2, identity: 0.946

tgcatcccttgtcctgcttggctttaataggggtaga	CRISPR spacer
tgcatcccttgccctgcttggctttaataggggtgga	Protospacer
***********.**********************.**

5. spacer 2.1|269429|25|NC_007776|CRISPRCasFinder matches to position: 1663884-1663908, mismatch: 2, identity: 0.92

tgtcgctacgcgacgctaacgcgaa	CRISPR spacer
tgttgctacgcaacgctaacgcgaa	Protospacer
***.*******.*************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_007776_2 2.1|269429|25|NC_007776|CRISPRCasFinder 269429-269453 25 NC_019772 Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence 67234-67258 4 0.84

1. spacer 2.1|269429|25|NC_007776|CRISPRCasFinder matches to NC_019772 (Anabaena cylindrica PCC 7122 plasmid pANACY.01, complete sequence) position: , mismatch: 4, identity: 0.84

tgtcgctacgcgacgctaacgcgaa	CRISPR spacer
ccttgctacgcaacgctaacgcgaa	Protospacer
. *.*******.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3371 : 66604 45 Bacillus_virus(21.43%) tRNA,protease,transposase NA
DBSCAN-SWA_2 78034 : 126004 44 Thermus_phage(12.5%) tRNA,protease,transposase NA
DBSCAN-SWA_3 210424 : 270751 53 Paenibacillus_phage(18.18%) protease,transposase NA
DBSCAN-SWA_4 605550 : 639850 29 Lactobacillus_virus(25.0%) protease,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage