Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_007948 Polaromonas sp. JS666, complete genome 12 crisprs WYL,cas3,RT,DinG,csa3,DEDDh 1 0 5 0
NC_007950 Polaromonas sp. JS666 plasmid 2, complete sequence 0 crisprs RT,c2c9_V-U4 0 0 3 0
NC_007949 Polaromonas sp. JS666 plasmid 1, complete sequence 0 crisprs PD-DExK 0 0 0 0

Results visualization

1. NC_007948
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_1 414085-414169 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_2 876571-876693 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_3 977338-977459 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_4 1656040-1656162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_5 2218314-2218404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_6 3110165-3110273 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_7 3364748-3364873 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_8 3864041-3864152 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_9 4082022-4082158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_10 4888662-4888784 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_11 4983508-4983639 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_007948_12 5174538-5174647 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_007948_8 8.1|3864069|56|NC_007948|CRISPRCasFinder 3864069-3864124 56 NC_007948.1 264691-264746 0 1.0

1. spacer 8.1|3864069|56|NC_007948|CRISPRCasFinder matches to position: 264691-264746, mismatch: 0, identity: 1.0

actgcgctgccccccgagggggctgaacttgcttggggcggcccggcgctgcgttc	CRISPR spacer
actgcgctgccccccgagggggctgaacttgcttggggcggcccggcgctgcgttc	Protospacer
********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2274359 : 2282859 9 Tupanvirus(14.29%) NA NA
DBSCAN-SWA_2 3926109 : 3956540 37 Pseudomonas_phage(17.39%) integrase,plate,tRNA,protease,tail,transposase attL 3949605:3949620|attR 3960152:3960167
DBSCAN-SWA_3 3963318 : 3973429 18 uncultured_Caudovirales_phage(25.0%) head NA
DBSCAN-SWA_4 4702548 : 4711406 9 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_5 5078214 : 5121872 39 Lysinibacillus_phage(33.33%) integrase,transposase attL 5087717:5087735|attR 5121107:5121125
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_007950
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 60191 : 91040 28 Streptococcus_phage(25.0%) holin,transposase NA
DBSCAN-SWA_2 105459 : 156865 49 Escherichia_phage(22.22%) integrase,transposase attL 135805:135822|attR 163230:163247
DBSCAN-SWA_3 227938 : 298267 58 Stx2-converting_phage(21.43%) integrase,transposase,tRNA attL 262458:262473|attR 308976:308991
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage