Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008255 Cytophaga hutchinsonii ATCC 33406, complete sequence 3 crisprs csa3,WYL,DEDDh,cas3,DinG,cas6,PD-DExK 0 1 1 0

Results visualization

1. NC_008255
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008255_1 1148705-1148799 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008255_2 1225876-1225965 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008255_3 1585297-1585623 Orphan NA
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_008255_3 3.1|1585315|24|NC_008255|CRT 1585315-1585338 24 NC_031944 Synechococcus phage S-WAM1 isolate 0810PA09, complete genome 109697-109720 3 0.875
NC_008255_3 3.1|1585315|24|NC_008255|CRT 1585315-1585338 24 GU071094 Synechococcus phage S-SM1, complete genome 105253-105276 3 0.875

1. spacer 3.1|1585315|24|NC_008255|CRT matches to NC_031944 (Synechococcus phage S-WAM1 isolate 0810PA09, complete genome) position: , mismatch: 3, identity: 0.875

tagcaggcgctgcttttttagcaa	CRISPR spacer
gagcagtcgctgctttgttagcaa	Protospacer
 ***** ********* *******

2. spacer 3.1|1585315|24|NC_008255|CRT matches to GU071094 (Synechococcus phage S-SM1, complete genome) position: , mismatch: 3, identity: 0.875

tagcaggcgctgcttttttagcaa	CRISPR spacer
gagcagtcgctgctttgttagcaa	Protospacer
 ***** ********* *******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3868786 : 3876891 8 Streptococcus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage