1. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgac Protospacer
** *********************
2. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 1, identity: 0.958
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgac Protospacer
** *********************
3. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgac Protospacer
** *********************
4. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgac Protospacer
** *********************
5. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.958
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgac Protospacer
** *********************
6. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP046709 (Nostoc sp. ATCC 53789 plasmid pNsp_f, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
7. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgag Protospacer
** ********************
8. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
9. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
10. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
11. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
12. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
13. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
14. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
15. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
16. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
17. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
18. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
19. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
20. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
21. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
22. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
23. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
24. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
25. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
26. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
27. spacer 1.1|606901|24|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
28. spacer 1.1|606901|24|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
29. spacer 1.1|606901|24|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
30. spacer 1.1|606901|24|NC_008711|CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcgac Protospacer
* *********************
31. spacer 1.1|606901|24|NC_008711|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
32. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP026686 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
cgcgacggcgacggcgacggcgac Protospacer
.* *********************
33. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
cgagacggcaacggcgacggcgac Protospacer
.********.**************
34. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcgac Protospacer
* *********************
35. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
36. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggaggcggcgacggcgacggcgac Protospacer
***.*******************
37. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
38. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
39. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
40. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
41. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
42. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
43. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
44. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
45. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
46. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
47. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
48. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
49. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
50. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
51. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
52. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
53. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
54. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
55. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
56. spacer 1.1|606901|24|NC_008711|CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgac Protospacer
* *********************
57. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacgccgacggcgac Protospacer
** ********** **********
58. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacgccgacggcgac Protospacer
** ********** **********
59. spacer 1.1|606901|24|NC_008711|CRT matches to MH572413 (Microviridae sp. isolate SD_SF_6, complete genome) position: , mismatch: 2, identity: 0.917
tgagacggcgacggcgacggcgac CRISPR spacer
tgagacggcgacggcgacgggaac Protospacer
******************** .**
60. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.933
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacgacgacggcgacggcgacggcgac Protospacer
* ***************************
61. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
62. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
63. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
64. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
65. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
66. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacggcgacggcgacggcgac Protospacer
*********************
67. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP046709 (Nostoc sp. ATCC 53789 plasmid pNsp_f, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
68. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacggcgac Protospacer
*********************
69. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
aacgacggcgacggcgacggcgac Protospacer
. *********************
70. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacggcgacggcgacggcgac Protospacer
*********************
71. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tccgacggcgacggcaacggcgac Protospacer
* ************.********
72. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcgacggcgacggcgacagcgac Protospacer
* ***************.*****
73. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgacagcgacggcgac Protospacer
* *********.***********
74. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacagcgac Protospacer
* ***************.*****
75. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgagggcgacggcgacggcgac Protospacer
* ** ******************
76. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcggc Protospacer
* *******************.*
77. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgtc Protospacer
* ******************* *
78. spacer 1.1|606901|24|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgag Protospacer
* ********************
79. spacer 1.1|606901|24|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgagggcgacggcgacggcgac Protospacer
* ** ******************
80. spacer 1.1|606901|24|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcggc Protospacer
* *******************.*
81. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ctcgacggcgacggcgacggcgac Protospacer
. *********************
82. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgaccgcgac Protospacer
* *************** *****
83. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacggcgacggcgacggcgac Protospacer
*********************
84. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
85. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcgacggcgacggcgacagcgac Protospacer
* ***************.*****
86. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
gacgacggcgacggcgacggcgac Protospacer
. *********************
87. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacgacgacggcgacggcgac Protospacer
* ****.****************
88. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcgacggcgacggcgacagcgac Protospacer
* ***************.*****
89. spacer 1.1|606901|24|NC_008711|CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggtgtcggcgacggcgacggcgac Protospacer
* * *******************
90. spacer 1.1|606901|24|NC_008711|CRT matches to CP003955 (Rhodococcus opacus PD630 plasmid 6, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ctcgacggcgacggcgacggcgac Protospacer
. *********************
91. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgaa Protospacer
* ********************
92. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcggcggcgacggcgacggcgac Protospacer
* *.*******************
93. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcgaa Protospacer
* ********************
94. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP045327 (Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcgacggcgacggcgacggcgag Protospacer
* ********************
95. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
sgcgacggcgacggcgacggcgat Protospacer
* ********************.
96. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tctcacggcgacggcgacggcgac Protospacer
* ********************
97. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcggc Protospacer
* *******************.*
98. spacer 1.1|606901|24|NC_008711|CRT matches to NC_003270 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120epsilon, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgacggcgacggcgaa Protospacer
* ********************
99. spacer 1.1|606901|24|NC_008711|CRT matches to NC_003270 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120epsilon, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgaaggcgacggcgac Protospacer
* ******** ************
100. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agagacggcaacggcgacggcgaa Protospacer
********.*************
101. spacer 1.1|606901|24|NC_008711|CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggctacggcgacggcgacggcgac Protospacer
* ********************
102. spacer 1.1|606901|24|NC_008711|CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggctac Protospacer
* ****************** **
103. spacer 1.1|606901|24|NC_008711|CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggctacggcgacggcgacggcgac Protospacer
* ********************
104. spacer 1.1|606901|24|NC_008711|CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggctac Protospacer
* ****************** **
105. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
cgaggcgccgacggcgacggcgac Protospacer
.***.** ****************
106. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgatggcgacggcgac Protospacer
* ********.************
107. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgatggcgacggcgac Protospacer
* ********.************
108. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgccggcgacggcgacggcgac Protospacer
* * *******************
109. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgccggcgacggcgacggcgac Protospacer
* * *******************
110. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
agcgacggcgatggcgacggcgac Protospacer
* ********.************
111. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggtgacggcgacggcgac Protospacer
* *****.***************
112. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
cgtgccggcgacggcgacggcgac Protospacer
.* * *******************
113. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgcc Protospacer
* ******************* *
114. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttggccggcgacggcgacggcgac Protospacer
* .* *******************
115. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgcc Protospacer
* ******************* *
116. spacer 1.1|606901|24|NC_008711|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacagcgacggcgacggcgac Protospacer
* ***.*****************
117. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tccgacggcgacggcgacggcgcc Protospacer
* ******************* *
118. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggagacggcgccggcgacggcaac Protospacer
********* **********.**
119. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgccggcgacggcgacggcgac Protospacer
* * *******************
120. spacer 1.1|606901|24|NC_008711|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgtgacggcgacggcgacggccag Protospacer
** ****************** *
121. spacer 1.1|606901|24|NC_008711|CRT matches to NC_005262 (Burkholderia cepacia phage Bcep22, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggccag Protospacer
** ****************** *
122. spacer 1.1|606901|24|NC_008711|CRT matches to MH370375 (Salmonella phage S124, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgcc Protospacer
* ******************* *
123. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgaaggcgacggcgacggcgaa Protospacer
** ** *****************
124. spacer 1.1|606901|24|NC_008711|CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggatgcggcgacggcgacggcgac Protospacer
** .*******************
125. spacer 1.1|606901|24|NC_008711|CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgggccggcgacggcgacggcgag Protospacer
**.* ******************
126. spacer 1.1|606901|24|NC_008711|CRT matches to NC_020303 (Corynebacterium halotolerans YIM 70093 = DSM 44683 plasmid pCha1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
cgagacggcgacggcgacgtagac Protospacer
.****************** ***
127. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgatggcgat Protospacer
** **************.*****.
128. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgaaggcgacggcgacggcgac Protospacer
* ** ******************
129. spacer 1.1|606901|24|NC_008711|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgtc Protospacer
* ******************* *
130. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
tgagatggcgccggcgacggcgag Protospacer
*****.**** ************
131. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggacacggcgacggcgaaggcgac Protospacer
** ************* ******
132. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgccggcgacggcgacggcgac Protospacer
* * *******************
133. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ttcgacggcaacggcgacggcgac Protospacer
* ******.**************
134. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP013052 (Sinorhizobium americanum CCGM7 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacgtcgacggcgacggcgac Protospacer
* **** ****************
135. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgccggcgacggcgacggcgac Protospacer
* * *******************
136. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP010864 (Marinovum algicola DG 898 plasmid pMaD9, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
cgagaccgcggcggcgacggcgac Protospacer
.***** ***.*************
137. spacer 1.1|606901|24|NC_008711|CRT matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcaacggcgac Protospacer
* ************.********
138. spacer 1.1|606901|24|NC_008711|CRT matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 3, identity: 0.875
tgagacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcaac Protospacer
* ******************.**
139. spacer 1.2|606949|24|NC_008711|CRT matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 3, identity: 0.875
tgagacggcgactgagacggcgac CRISPR spacer
cgagacgccgaccgagacggcgac Protospacer
.****** ****.***********
140. spacer 1.2|606949|24|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgactgagacggcgac CRISPR spacer
tgggacggcgactgggacggcgaa Protospacer
**.***********.********
141. spacer 1.2|606949|24|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 3, identity: 0.875
tgagacggcgactgagacggcgac CRISPR spacer
tgggacggcgactgggacggcgaa Protospacer
**.***********.********
142. spacer 1.5|607081|30|NC_008711|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaagacgacaacggcgacggcgacggcgac Protospacer
.*******.********************
143. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgacggcgaa Protospacer
** ****.*********************
144. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
145. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
146. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
147. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
148. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
149. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
150. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
151. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
152. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
153. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
154. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
155. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
156. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
157. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
158. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
159. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggaggcggcgacggcgacggcgacggcgac Protospacer
***.**.**********************
160. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgacggcgaa Protospacer
** ****.*********************
161. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgacggcgaa Protospacer
** ****.*********************
162. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgacggcgaa Protospacer
** ****.*********************
163. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgacggcgacggcgacggcgacggcgaa Protospacer
** ****.*********************
164. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
165. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
166. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
167. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
168. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
169. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
170. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
171. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
172. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
173. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
174. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
175. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
176. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
177. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
178. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
179. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
180. spacer 1.5|607081|30|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 3, identity: 0.9
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgac Protospacer
* ****.**********************
181. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
acggacggcgacagcgacggcgac Protospacer
.*********.***********
182. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgac Protospacer
.* .*******************
183. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
ctggtcggcgacggcgacggcgac Protospacer
. .* *******************
184. spacer 1.1|606901|24|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccgccggcgacggcgacggcgac Protospacer
* *******************
185. spacer 1.1|606901|24|NC_008711|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gtcaacggcgacggcgacggcgac Protospacer
.********************
186. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgac Protospacer
.* .*******************
187. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgac Protospacer
.* .*******************
188. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
ggcgamsgcgacggcgacggcgac Protospacer
* ** *****************
189. spacer 1.1|606901|24|NC_008711|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gacaacggcgacggcgacggcgac Protospacer
. .********************
190. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
aaggacggtgacggcgacggcgac Protospacer
..*****.***************
191. spacer 1.1|606901|24|NC_008711|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gaggacggcgacggcgacgacgac Protospacer
..****************.****
192. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gcggacggcgacggcgtcggcgac Protospacer
.************* *******
193. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacggcgacggcaacggcgac Protospacer
************.********
194. spacer 1.1|606901|24|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gacggcggcgacggcgacggcgac Protospacer
. *.*******************
195. spacer 1.1|606901|24|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccggcggcgacggcgacggcgac Protospacer
*.*******************
196. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gttgacggcgacggcgacggcgcc Protospacer
******************* *
197. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccggcggcgacggcgacggcgac Protospacer
*.*******************
198. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gacggcggcgacggcgacggcgac Protospacer
. *.*******************
199. spacer 1.1|606901|24|NC_008711|CRT matches to NC_014811 (Mycolicibacterium gilvum Spyr1 plasmid pMSPYR101, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gttgacggcgacggcgacggcgcc Protospacer
******************* *
200. spacer 1.1|606901|24|NC_008711|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
ctggacggcgacagcgacggcgac Protospacer
. .*********.***********
201. spacer 1.1|606901|24|NC_008711|CRT matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gttgacggcgacggcgacggcgcc Protospacer
******************* *
202. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cacgacggcgaaggcgacggcgac Protospacer
.. ******** ************
203. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gaggacggcgacggcgacgacgac Protospacer
..****************.****
204. spacer 1.1|606901|24|NC_008711|CRT matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacgacgacggcgacggcgac Protospacer
****.****************
205. spacer 1.1|606901|24|NC_008711|CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gccgacgacgacggcgacggcgac Protospacer
****.****************
206. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacgccgac Protospacer
**************** ****
207. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gacgtcggcgacggcgacggcgac Protospacer
. * *******************
208. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
ctcgtcggcgacggcgacggcgac Protospacer
. * *******************
209. spacer 1.1|606901|24|NC_008711|CRT matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
acggacggcgagggcgacggcgac Protospacer
.******** ************
210. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cacgacggcgacggcgacgccgac Protospacer
.. **************** ****
211. spacer 1.1|606901|24|NC_008711|CRT matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacgtcgac Protospacer
**************** ****
212. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gtcgacggcgacggtgacggcgac Protospacer
***********.*********
213. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
cacgacggcgacagcgacggcgac Protospacer
.. *********.***********
214. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
gctgacgtcgacggcgacggcgac Protospacer
**** ****************
215. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
ggcatcggcgacggcgacggcgac Protospacer
* . *******************
216. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
atcgacggtgacggcgacggcgac Protospacer
*****.***************
217. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 4, identity: 0.833
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacgccgac Protospacer
**************** ****
218. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgagggcgacggcgacggcgacggcgac Protospacer
* ** *.**********************
219. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP010801 (Ralstonia mannitolilytica strain SN82F48 plasmid pRMAN01, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcggc Protospacer
* ****.********************.*
220. spacer 1.5|607081|30|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgagggcgacggcgacggcgacggcgac Protospacer
* ** *.**********************
221. spacer 1.5|607081|30|NC_008711|CRT matches to NC_019369 (Burkholderia cepacia plasmid pYS1, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcggc Protospacer
* ****.********************.*
222. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP046709 (Nostoc sp. ATCC 53789 plasmid pNsp_f, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgaa Protospacer
* ****.*********************
223. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaagacgacagcggcgacggcgacggcgac Protospacer
.*******..*******************
224. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgag Protospacer
* ****.*********************
225. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcgacggcgaa Protospacer
* ****.*********************
226. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgacgcaacgacggcgacggcgacggcgac Protospacer
.** .*.***********************
227. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacggcgacggcgacggcgacggcgtc Protospacer
* ****.******************** *
228. spacer 1.5|607081|30|NC_008711|CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgtcggcgacggcgacggcgacggcgac Protospacer
* * **.**********************
229. spacer 1.5|607081|30|NC_008711|CRT matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 4, identity: 0.867
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcaacggcgac Protospacer
* ****.*************.********
230. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gcgatcggcgacggcgacggcgac Protospacer
.. *******************
231. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacggcgga Protospacer
*******************.
232. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gcgatcggcgacggcgacggcgac Protospacer
.. *******************
233. spacer 1.1|606901|24|NC_008711|CRT matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gctatcggcgacggcgacggcgac Protospacer
. *******************
234. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gcctgcggcgacggcgacggcgac Protospacer
.*******************
235. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gacagcggcgacggcgacggcgac Protospacer
. ..*******************
236. spacer 1.1|606901|24|NC_008711|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gacaccggcgacggcgacggcgac Protospacer
. . *******************
237. spacer 1.1|606901|24|NC_008711|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
ctgcgcggcgacggcgacggcgac Protospacer
. . .*******************
238. spacer 1.1|606901|24|NC_008711|CRT matches to NC_005307 (Gordonia westfalica strain DSM44215T plasmid pKB1 complete genome) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacggcgga Protospacer
*******************.
239. spacer 1.1|606901|24|NC_008711|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
gcggacggcgacggcgacggcggg Protospacer
.*******************.
240. spacer 1.1|606901|24|NC_008711|CRT matches to CP016643 (Mycobacterium sp. djl-10 plasmid djl-10_3, complete sequence) position: , mismatch: 5, identity: 0.792
tgagacggcgacggcgacggcgac CRISPR spacer
cttgacggcgacggcgacggcgtg Protospacer
. *******************
241. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgacggcgac Protospacer
.* .**.**********************
242. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgacggcgacggcgacggcgacagcgac Protospacer
****.****************.*****
243. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
acggaggccgacggcgacggcgacggcgac Protospacer
.** * **********************
244. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tccgacggcgacggcaacggcgacggcgag Protospacer
* ****.*******.*************
245. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgacggcgac Protospacer
.* .**.**********************
246. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgccgcggcgacggcgacggcgacggcgac Protospacer
.* .**.**********************
247. spacer 1.5|607081|30|NC_008711|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcaacggcgacggcgacggcgacggcgac Protospacer
.***.**********************
248. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cagcacgccgacggcgacggcgacggcgac Protospacer
... *** **********************
249. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caagacgacggcggcgacggcgacgccgat Protospacer
..********.************** ***.
250. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgccggcgacggcgacggcgacggcgac Protospacer
* **.**********************
251. spacer 1.5|607081|30|NC_008711|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgacgaggacggcgacggcgacgacgac Protospacer
. ***** ****************.****
252. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacggcgacggcgacggcgaccgcgac Protospacer
. ****.**************** *****
253. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgaggacggcggcgacggcgacggcgac Protospacer
** ****.*******************
254. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacga-cgacggcgacggcgacggcgac CRISPR spacer
-gcggcggccggcggcgacggcgacggcgac Protospacer
* *.**. **.*******************
255. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctggtcggcgacggcgacggcgacggcgac Protospacer
. .* **.**********************
256. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgaggacggcggcgacggcgacggcgac Protospacer
** ****.*******************
257. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacga-cgacggcgacggcgacggcgac CRISPR spacer
-gcggcggccggcggcgacggcgacggcgac Protospacer
* *.**. **.*******************
258. spacer 1.5|607081|30|NC_008711|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctggacggcgacagcgacggcgacggcgac Protospacer
. .****.****.*****************
259. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP045327 (Mycobacterium sp. THAF192 plasmid pTHAF192_b, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcagacttcgacggcgacggcgacggcgag Protospacer
**** *********************
260. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgacgaggacggcgacggcgacgacgac Protospacer
. ***** ****************.****
261. spacer 1.5|607081|30|NC_008711|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtagacgacgacgtcgacggcggcggcgat Protospacer
*********** ********.******.
262. spacer 1.5|607081|30|NC_008711|CRT matches to MN369761 (Mycobacterium phage Malthus, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcggcgacggtgac Protospacer
. *************.*********.***
263. spacer 1.5|607081|30|NC_008711|CRT matches to MK224497 (Mycobacterium phage Henu3, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcgacgacggcgac Protospacer
. *************.**.**********
264. spacer 1.5|607081|30|NC_008711|CRT matches to AP018469 (Mycobacterium phage Y10 DNA, complete genome, note: sample1) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcggcgacggtgac Protospacer
. *************.*********.***
265. spacer 1.5|607081|30|NC_008711|CRT matches to KT809302 (Haloarcula californiae icosahedral virus 1, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaggacgacgacagcgacgacgacggcgac Protospacer
..*********.******.**********
266. spacer 1.5|607081|30|NC_008711|CRT matches to AP018470 (Mycobacterium phage Y2 DNA, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcggcgacggtgac Protospacer
. *************.*********.***
267. spacer 1.5|607081|30|NC_008711|CRT matches to MT310882 (Mycobacterium phage JF1, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcggcgacggtgac Protospacer
. *************.*********.***
268. spacer 1.5|607081|30|NC_008711|CRT matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
acggacgacgagggcgacgacgacggcgac Protospacer
.******** *******.**********
269. spacer 1.5|607081|30|NC_008711|CRT matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgacgacgacggcgacgacgacgacgag Protospacer
* ****************.*****.***
270. spacer 1.5|607081|30|NC_008711|CRT matches to AP018471 (Mycobacterium phage Y10 DNA, complete genome, note: sample2) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgacgacgacggcggcggcgacggtgac Protospacer
. *************.*********.***
271. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tccggtgccgacggcgacggcgacggcgac Protospacer
* *..* **********************
272. spacer 1.5|607081|30|NC_008711|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaagacgacgacggcgacggcgttggcggc Protospacer
.******************** .****.*
273. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcggcggcgacggcgacggcgacggcgaa Protospacer
* *.**.*********************
274. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tctcacggcgacggcgacggcgacggcggc Protospacer
* ***.********************.*
275. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011275 (Planctomyces sp. SH-PL62 plasmid pPL62-2, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcgacgacgacggcgacggcgtccgcgag Protospacer
.* ******************* * ****
276. spacer 1.5|607081|30|NC_008711|CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctacggcgacggcgacggcgacggctac Protospacer
* ***.******************* **
277. spacer 1.5|607081|30|NC_008711|CRT matches to NC_020489 (Rhodobacter phage RcapNL, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctacggctacggcgacggcgacggcgac Protospacer
* ***.* ********************
278. spacer 1.5|607081|30|NC_008711|CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctacggcgacggcgacggcgacggctac Protospacer
* ***.******************* **
279. spacer 1.5|607081|30|NC_008711|CRT matches to JF974309 (Rhodobacter phage RcNL1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctacggctacggcgacggcgacggcgac Protospacer
* ***.* ********************
280. spacer 1.5|607081|30|NC_008711|CRT matches to JQ807227 (Environmental Halophage eHP-6, partial genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgatgacgatggcgacggcgacggcgat Protospacer
* **.*****.*****************.
281. spacer 1.5|607081|30|NC_008711|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gggaacgacggcggcgacggcgacgacgac Protospacer
*..******.**************.****
282. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcgccgacgtcggcgacggcgacggcgtc Protospacer
* * ***** ***************** *
283. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP024936 (Paraburkholderia graminis strain PHS1 plasmid pPHS1_P, complete sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgccggcgacggcgacggcgacggcgcc Protospacer
.* * **.******************** *
284. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttggccggcgacggcgacggcgacggcgcc Protospacer
* .* **.******************** *
285. spacer 1.5|607081|30|NC_008711|CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 5, identity: 0.833
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgatggtgacggcgacggcgacggcgac Protospacer
* **.*..*********************
286. spacer 1.1|606901|24|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.75
tgagacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgcg Protospacer
******************
287. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaggtcggcgacgacgacggcgacggcgac Protospacer
..* **.*****.****************
288. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gacgacggcgacggcgacggcgacatgacg Protospacer
************************
289. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tacgacgacgcccgcgacggcgacggcacc Protospacer
*. ******* * **************. *
290. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgatcggcgacggcgacggcgacggcgac Protospacer
.. **.**********************
291. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tacgacgacgcccgcgacggcgacggcacc Protospacer
*. ******* * **************. *
292. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tacgacgacgcccgcgacggcgacggcacc Protospacer
*. ******* * **************. *
293. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgatcggcgacggcgacggcgacggcgac Protospacer
.. **.**********************
294. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP046709 (Nostoc sp. ATCC 53789 plasmid pNsp_f, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctctggcgacggcgacggcgacggcgac Protospacer
* .*.**********************
295. spacer 1.5|607081|30|NC_008711|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcagcgtcaacggcgacggcgacggcgac Protospacer
.* ..** *.********************
296. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgttgcgacgacggcgacggcggcggggag Protospacer
** .*****************.*** **
297. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tccgcagccgccggcgacggcgacggcgac Protospacer
* * * ** *******************
298. spacer 1.5|607081|30|NC_008711|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgggcgacgacgaggacggcgacggcgac Protospacer
. .*.********. ***************
299. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP015741 (Shinella sp. HZN7 plasmid pShin-05, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttctatctcgacggcgacggcgacggcgac Protospacer
* *. **********************
300. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgggcgacgacggcgacggcgacgacgag Protospacer
. .*.********************.***
301. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtggcgacgagggcgaccgcgacggcgag Protospacer
.* *.****** ****** **********
302. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgggcgacgacggcgacggcgacgacgag Protospacer
. .*.********************.***
303. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtggcgacgagggcgaccgcgacggcgag Protospacer
.* *.****** ****** **********
304. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgggcgacgacgaggacggcgacggcgac Protospacer
. .*.********. ***************
305. spacer 1.5|607081|30|NC_008711|CRT matches to KC252997 (Halovirus PH1, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
accgacgacgacggcgacagcgacgacgag Protospacer
***************.******.***
306. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
sgcgacggcgacggcgacggcgatggcgcg Protospacer
* ****.***************.****
307. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgacgacgacggtgacggcgacggcccc Protospacer
. ***********.************ *
308. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcctggacgtcggcgacggcgacggcgac Protospacer
* **** *******************
309. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgtcgacgacggcgacggcgacgccgat Protospacer
. * ******************** ***.
310. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LR134444 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgaggacgacggcgaccgcgacggcgag Protospacer
. ** ************ **********
311. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caccacgccgacggcgacggcaacggcgac Protospacer
.. *** *************.********
312. spacer 1.5|607081|30|NC_008711|CRT matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgtcgacgacggcgacggcgacgccgat Protospacer
. * ******************** ***.
313. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026686 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM4, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctcgcccgcgacggcgacggcgacggcgac Protospacer
. * * .**********************
314. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026686 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM4, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcgacggcgacggcgacggcgaccgctcc Protospacer
.* ****.**************** ** *
315. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgtcgacgacggcgacggcgacgccgat Protospacer
. * ******************** ***.
316. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgtcgacgacggcgacggcgacgccgat Protospacer
. * ******************** ***.
317. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacga----cgacggcgacggcgacggcgac CRISPR spacer
----gcgatgttcggcggcgacggcgacggcgac Protospacer
.*** **.*******************
318. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgacgacgacggcggcggcgacggccgc Protospacer
*************.********** .*
319. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgggcgacgccggcgacgccgacggcgac Protospacer
. .*.***** ******** **********
320. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgaggacgacggcgacggcgacggccgc Protospacer
. ** ********************* .*
321. spacer 1.5|607081|30|NC_008711|CRT matches to NC_004689 (Mycobacterium phage Barnyard, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
aactacgactacggcgacgacgacggcgac Protospacer
. ***** *********.**********
322. spacer 1.5|607081|30|NC_008711|CRT matches to MN813684 (Microbacterium phage Terij, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
aacggcgacgagggcgacggcgacggcgag Protospacer
. *.****** *****************
323. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaacccgacgacgtcgacggtgacggcgac Protospacer
.* ******** ******.*********
324. spacer 1.5|607081|30|NC_008711|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtagcgacaccggcgacggcgacggcgac Protospacer
* ..****. *******************
325. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccggccacgacggcgacggcgacgccgac Protospacer
*.* ****************** ****
326. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcgacggcaacggcgacggcgacggcgcg Protospacer
* ****.*.******************
327. spacer 1.5|607081|30|NC_008711|CRT matches to NC_013386 (Ammonifex degensii KC4 plasmid pADEG01, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
aacggcgacgacggcgacgacaacggcgac Protospacer
. *.**************.*.********
328. spacer 1.5|607081|30|NC_008711|CRT matches to NC_003270 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120epsilon, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgaaagcgacggcgacggcgacggcgaa Protospacer
* ** ..*********************
329. spacer 1.5|607081|30|NC_008711|CRT matches to NC_003270 (Nostoc sp. PCC 7120 = FACHB-418 plasmid pCC7120epsilon, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgaaagcgacggcgaaggcgacggcgac Protospacer
* ** ..********* ************
330. spacer 1.5|607081|30|NC_008711|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggaagagacgacggcgacggagtcggcgac Protospacer
**.. ************** * *******
331. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gggcagcacgacggcgaaggcgacggcgac Protospacer
*. * ********** ************
332. spacer 1.5|607081|30|NC_008711|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgacgacggcggccacggcgacggcgtc Protospacer
. *******.**** ************ *
333. spacer 1.5|607081|30|NC_008711|CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caggacgacgacgccgacggcgacgggggc Protospacer
...********** ************ *.*
334. spacer 1.5|607081|30|NC_008711|CRT matches to KT221033 (Streptomyces phage SF1, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caggacgacgacgccgacggcgacgggggc Protospacer
...********** ************ *.*
335. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgaggcgccgacggcgacggcgacgaggaa Protospacer
.***.** *****************. **
336. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgccgacgaaggcgacggggacggcggc Protospacer
* * ****** ******** *******.*
337. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgggccagcgacggcgatggcgacggcgac Protospacer
.*.* *..*********.************
338. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgggccagcgacggcgatggcgacggcgac Protospacer
.*.* *..*********.************
339. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgttggcgccggcgacggcgacggcgac Protospacer
.* * .*.** *******************
340. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgttggcgccggcgacggcgacggcgac Protospacer
.* * .*.** *******************
341. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgggccagcgacggcgatggcgacggcgac Protospacer
.*.* *..*********.************
342. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cggcaggacggcggcgaaggcgacggcgac Protospacer
.*. * ****.****** ************
343. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cggcaggacggcggcgaaggcgacggcgac Protospacer
.*. * ****.****** ************
344. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caaggagtcgacggcgacggtgacggcgac Protospacer
..**. * ************.*********
345. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgttggcgccggcgacggcgacggcgac Protospacer
.* * .*.** *******************
346. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgttggcgccggcgacggcgacggcgac Protospacer
.* * .*.** *******************
347. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgttggcgccggcgacggcgacggcgac Protospacer
.* * .*.** *******************
348. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgtcggcgacggcgaaggcgacggcgaa Protospacer
* * **.********* ***********
349. spacer 1.5|607081|30|NC_008711|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcggtgacgaaggcgacggcgacggcggc Protospacer
* *..***** ****************.*
350. spacer 1.5|607081|30|NC_008711|CRT matches to KY965934 (Halorubrum pleomorphic virus 9 strain B2-2/SS5-4, complete genome) position: , mismatch: 6, identity: 0.8
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgtgacgacgccggcgacggcgaccgcacc Protospacer
.* ******* ************* **. *
351. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacggaaag Protospacer
*.**********************
352. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcgccacggacggcgacagcgacggcgac Protospacer
* * *. *********.***********
353. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacgcaggg Protospacer
*.**********************
354. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacacaaag Protospacer
*.**********************
355. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacggaaag Protospacer
*.**********************
356. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacggaaag Protospacer
*.**********************
357. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacgcaggg Protospacer
*.**********************
358. spacer 1.5|607081|30|NC_008711|CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacggctca Protospacer
*.**********************
359. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gccgacggcgacggcgacggcgacggcgcg Protospacer
* **********************
360. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
aacgacaccgacggcgacggcgacggcgga Protospacer
. ***. ********************.
361. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
catggcgacgaccgcgaccgcgacggcgat Protospacer
.. *.******* ***** **********.
362. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgagacgacgacggccacggcgcccagcac Protospacer
.************** ****** * . **
363. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctggccaacgacaccgacggcgacggcgac Protospacer
. .* *.*****. ****************
364. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggccgtggtgacggcgacggcgacggcgac Protospacer
* ..*..*********************
365. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtgtccaccgacggcgacggcgacggcgac Protospacer
. *. **********************
366. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------aacgacggcgacggcgacggcgacggggtc Protospacer
.***********************
367. spacer 1.5|607081|30|NC_008711|CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttccgcaacgacgtcgacggcgagggcgac Protospacer
* .*.****** ********* ******
368. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gacggcggcgacggcgacggcgacggcaag Protospacer
****.*******************
369. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
agcttcgccgacggcgacggcgacggcacc Protospacer
* ** *******************. *
370. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
agcttcgccgacggcgacggcgacggcacc Protospacer
* ** *******************. *
371. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gacggcggcgacggcgacggcgacggcaag Protospacer
****.*******************
372. spacer 1.5|607081|30|NC_008711|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcctcgacgacgtcgatggcgacggcgtc Protospacer
.* ******** ***.********** *
373. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttccgcaacgacgtcgacggcgagggcgac Protospacer
* .*.****** ********* ******
374. spacer 1.5|607081|30|NC_008711|CRT matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgacgtcggt Protospacer
*.**********************
375. spacer 1.5|607081|30|NC_008711|CRT matches to MK719750 (Rheinheimera phage vB_RspM_Barba31A, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggctatggtgacggcgacggcgacggcaac Protospacer
* *.*..******************.**
376. spacer 1.5|607081|30|NC_008711|CRT matches to KT809302 (Haloarcula californiae icosahedral virus 1, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacggtgacgacggcgacgacgagggcgac Protospacer
. *..*************.*** ******
377. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gccgacggcgacggcgacggcgacctgccg Protospacer
* **********************
378. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gggggcgacgacggccacggcggcggcgga Protospacer
*.*.********** ******.*****.
379. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gacgtcggcgacggcgacggcgacgacgaa Protospacer
**** *******************
380. spacer 1.5|607081|30|NC_008711|CRT matches to NC_023286 (Streptomyces sp. F12 plasmid pFRL6, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcctcgacgacggcggcagcgacggcgcc Protospacer
.* ***********.*.********* *
381. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacgccggcgacgccgacggcgacggcggc Protospacer
. * **.***** **************.*
382. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026653 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gagcccgacgaggacgacggcgacggcgac Protospacer
.. ****** *.****************
383. spacer 1.5|607081|30|NC_008711|CRT matches to MK359320 (Mycobacterium phage Cookies, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
384. spacer 1.5|607081|30|NC_008711|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
385. spacer 1.5|607081|30|NC_008711|CRT matches to JF937106 (Mycobacterium phage SirDuracell, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
386. spacer 1.5|607081|30|NC_008711|CRT matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
387. spacer 1.5|607081|30|NC_008711|CRT matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
388. spacer 1.5|607081|30|NC_008711|CRT matches to MH399774 (Mycobacterium phage DoctorDiddles, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
389. spacer 1.5|607081|30|NC_008711|CRT matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgcgcgacgacggcgacggcgacagcgag Protospacer
. .*******************.****
390. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP024895 (Amycolatopsis sp. AA4 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tacctctacgacggcgacggcgccgccgac Protospacer
*. * *************** ** ****
391. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccgacgacgacggcgaaggcgccggcgga Protospacer
************** **** *****.
392. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cggtacggcgacggcgactgcgacggcgga Protospacer
.*. ***.********** *********.
393. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccagtcgacgtcggcgacggcgacggccgt Protospacer
. ** ***** **************** ..
394. spacer 1.5|607081|30|NC_008711|CRT matches to NC_004934 (Streptomyces violaceoruber strain SANK95570 plasmid pSV2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
accgacggcgacggcgacgtcgacggcggg Protospacer
****.*********** ********.
395. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcggacgtcgacggcgacggcgatggcggt Protospacer
.**** ***************.****..
396. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012886 (Mycobacterium chimaera strain AH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cacaagcacgacggcgacagcgacggcgac Protospacer
.. .* ***********.***********
397. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021817 (Sinorhizobium meliloti strain M270 plasmid accessoryC, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cctgaagacgaaggcgacggcgacggcggg Protospacer
. ** ***** ****************.
398. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
agcttcgccgacggcgacggcgacggcacc Protospacer
* ** *******************. *
399. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP038146 (Streptomyces sp. S501 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gagcacgacgagggcgacggcggcggcgag Protospacer
.. ******* **********.******
400. spacer 1.5|607081|30|NC_008711|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgccgacgacggcgagggcgacggtgtg Protospacer
* * ************ ********.*
401. spacer 1.5|607081|30|NC_008711|CRT matches to MK268344 (Salmonella phage Munch, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggtgacggcgacggcgacggcgacgatggt Protospacer
* ****.*****************..*..
402. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggagacgacgacgccgtcggcgacgcgatc Protospacer
************ ** ******** . *
403. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_KM409652 (Escherichia coli strain REL5382 plasmid pB15, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
404. spacer 1.5|607081|30|NC_008711|CRT matches to NC_009980 (Salmonella enterica subsp. enterica serovar Dublin plasmid pMAK2, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
405. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cacgacgacgacggcgaccgagacggccat Protospacer
.. *************** * ****** *.
406. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcgtcctcgtcggcgacggcgacggcgac Protospacer
* * ** *******************
407. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcgacgacgatgacgacggcgacggaacc Protospacer
.* ********.*.************ . *
408. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008460 (Escherichia coli plasmid pO86A1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
409. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cccgacgaggacgacgacggcgacggcaag Protospacer
. ***** ****.*************.*
410. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
411. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
412. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcggggggcgacggtgacggcgacggcgac Protospacer
.*. *.******.***************
413. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtagcggacgacggcgaccgcggcggcgat Protospacer
** ************ ***.******.
414. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013052 (Sinorhizobium americanum CCGM7 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tcgagtggcgacgtcgacggcgacggcgac Protospacer
* ....*.***** ****************
415. spacer 1.5|607081|30|NC_008711|CRT matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
416. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttcatcggcgacggcgacggcgagggcgag Protospacer
* . **.*************** *****
417. spacer 1.5|607081|30|NC_008711|CRT matches to MT711979 (Streptomyces phage Endor2, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcctacgacgacggccacggcgacgggtac Protospacer
*********** ********** **
418. spacer 1.5|607081|30|NC_008711|CRT matches to MN304824 (Catenulispora phage 69_17, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgcacgacgccggcgacgccgacggcgtc Protospacer
. . ****** ******** ******** *
419. spacer 1.5|607081|30|NC_008711|CRT matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcgtcgacgacggcggcggcgagggcgaa Protospacer
* ***********.****** *****
420. spacer 1.5|607081|30|NC_008711|CRT matches to KC292029 (Halovirus HCTV-1, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacggagacgacggcgacggtgacgccgac Protospacer
. *. **************.**** ****
421. spacer 1.5|607081|30|NC_008711|CRT matches to KC292029 (Halovirus HCTV-1, complete genome) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaatccgacgacggcgacggcgaagacgaa Protospacer
.* ****************** *.***
422. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacga----cgacggcgacggcgacggcgac CRISPR spacer
----gcgatgttcggcggcgacggcgacggcgaa Protospacer
.*** **.******************
423. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgcgaatgcgaaggcgacggcgacggcgaa Protospacer
.* ** .*** *****************
424. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 7, identity: 0.767
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cacggcaaggacggtgacggcgacggcgac Protospacer
.. *.*.* *****.***************
425. spacer 1.5|607081|30|NC_008711|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
426. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacggcgacggcgac------ Protospacer
** ****.****************
427. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgaaggacggcggcgacggcgacggcggt Protospacer
. ..* ****.*****************..
428. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacagcgacgggaag Protospacer
*.****************.*****
429. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gagatcgacgacggcgtcggcgagggcgcc Protospacer
... *********** ****** **** *
430. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.733
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacggcgacggcgac------ Protospacer
** ****.****************
431. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacggcgacggcgac------ Protospacer
** ****.****************
432. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacggcgacggcgac------ Protospacer
** ****.****************
433. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacggcgacggcgac------ Protospacer
** ****.****************
434. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gagatcgacgacggcgtcggcgagggcgcc Protospacer
... *********** ****** **** *
435. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP046709 (Nostoc sp. ATCC 53789 plasmid pNsp_f, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgaaggctaa Protospacer
*.*********************
436. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgcgcgacgacgtcgacggcgactgcgag Protospacer
. . .******** ********** ****
437. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
acccgcgacgacggcgacgatgacggcgat Protospacer
.**************..********.
438. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tgcgtcgacgacggcgacggcgaagaacgg Protospacer
** * ****************** *. .
439. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gagtacggcgacgccgacggcgacggcttc Protospacer
.. ***.***** ************* *
440. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cgctgcgaccacgccgacggcgacggcgcg Protospacer
.* .**** *** **************
441. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctggcgaacgacggcgacctcgacggcgac Protospacer
. .* .*********** **********
442. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
443. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgaaggaccg Protospacer
*.*********************
444. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------accgacggcgacggcgacggcgacaaccac Protospacer
. **********************
445. spacer 1.5|607081|30|NC_008711|CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtgcaccgcgacggcgacagcgacggcgat Protospacer
. ** .**********.**********.
446. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
447. spacer 1.5|607081|30|NC_008711|CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
aagtacgaagacgacgacggcgacggcgtt Protospacer
.. **** ****.************** .
448. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcctcgacgccggcgtcggcgacggcgcg Protospacer
* ***** ***** ***********
449. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgaaggcgacggcgacggcgacggtctg Protospacer
*.*** ******************
450. spacer 1.5|607081|30|NC_008711|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtggcggacgatggcgacggcggcggcgat Protospacer
.* *****.**********.******.
451. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgcgcgacgccggcgacggcgacggcgcg Protospacer
. . .***** *****************
452. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
453. spacer 1.5|607081|30|NC_008711|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gacaccggcgacggcgacggcgacggcgtc Protospacer
***. *******************
454. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccagtcgacgtcggcgacggcgacgaacgc Protospacer
. ** ***** **************. .*
455. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcgacggcgacggcgacggcgccggcgca Protospacer
*.******************** *
456. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgaccttcgacggcaacggcgacggcgac Protospacer
. .. * *******.**************
457. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ttccggcacggcggcgacggccacggcgac Protospacer
* . ***.********** ********
458. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gaccaccacgacagcgacggcgacggcggg Protospacer
. ** *****.***************.
459. spacer 1.5|607081|30|NC_008711|CRT matches to MK937607 (Gordonia phage Zipp, complete genome) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gccgacgacgacggcgacggcgacaaggcc Protospacer
* *****.****************
460. spacer 1.5|607081|30|NC_008711|CRT matches to MK937611 (Gordonia phage Verity, complete genome) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gccgacgacgacggcgacggcgacaaggcc Protospacer
* *****.****************
461. spacer 1.5|607081|30|NC_008711|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caccgctacgacggcgacggcggcggctac Protospacer
.. .* ***************.**** **
462. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gacctcgacgacggcgacgtcgacgggggc Protospacer
. ************** ****** *.*
463. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_LR134458 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 16, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
tcgatcgacgacggccgcggcgacggcgta Protospacer
* .. ********** .***********
464. spacer 1.5|607081|30|NC_008711|CRT matches to NC_007764 (Rhizobium etli CFN 42 plasmid p42c, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caagacgacgaccgcgacggcgacccacag Protospacer
..********** *********** *
465. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cggatgtacgacggcgacgcggacggcgac Protospacer
.*.. ************ *********
466. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP020908 (Rhizobium etli strain NXC12 plasmid pRetNXC12b, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caagacgacgaccgcgacggcgacccacag Protospacer
..********** *********** *
467. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
468. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
469. spacer 1.5|607081|30|NC_008711|CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ctgcgcggcgacggcgacggcgacgacgag Protospacer
. . .**.*****************.***
470. spacer 1.5|607081|30|NC_008711|CRT matches to NC_021907 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1b, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
caagacgacgaccgcgacggcgacccacag Protospacer
..********** *********** *
471. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgcgcggcgacggcggcggcgacggcggc Protospacer
. . .**.********.***********.*
472. spacer 1.5|607081|30|NC_008711|CRT matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cagtatgacgacggcgacggccacggcggg Protospacer
... *.*************** ******.
473. spacer 1.5|607081|30|NC_008711|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
474. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
475. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtcttcgacgacggcgacggtgacgccgtc Protospacer
***************.**** ** *
476. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP020556 (Streptomyces sp. Sge12 plasmid pSGE, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
cagggaatcgacggtgacggcgacggcgac Protospacer
...*. . ******.***************
477. spacer 1.5|607081|30|NC_008711|CRT matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 8, identity: 0.733
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtgcacgtcgaccgcgacggcgacggcgta Protospacer
. *** **** ***************
478. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.7
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggccggtgcgacggcgacggcgacggcgag------ Protospacer
** ****.***************
479. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---ggcaacgacgacgacgacgacgacggcaag Protospacer
*.*.******.*****.*****.**.*
480. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
atcctcgacgtcggcgatggcgacggcgtt Protospacer
***** ******.********** .
481. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---ggcaacgacgacgacgacgacgacggcaag Protospacer
*.*.******.*****.*****.**.*
482. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
accgtccgagacggcaacggcgacggcgac------ Protospacer
.******.*.**************
483. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
catcccgacgacggcaacggcgacggtctc Protospacer
.. **********.**********. *
484. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---atcgacgacggcggcgacggcggcggcgtt Protospacer
. ***********.**.**.*****.*
485. spacer 1.5|607081|30|NC_008711|CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gtcgacgacgacggcgacggcgccgtcgct Protospacer
* *****.************** *
486. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gcctacggcgaccgcgacggcgacggcttc Protospacer
* * ******** ***********
487. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccagtcgacgtcggcgacggcgacgaacgt Protospacer
. ** ***** **************. ..
488. spacer 1.5|607081|30|NC_008711|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ccgtcggacgacggcgacggcgacggccgg Protospacer
. . ********************* .
489. spacer 1.5|607081|30|NC_008711|CRT matches to NC_011142 (Iodobacteriophage phiPLPE, complete genome) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggctacggcgacggctacggcgacggctcc Protospacer
*.* *********** ********
490. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gaagacgacaacggcgacggcgacaccacg Protospacer
** ****.*.**************
491. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gaagacgacaacggcgacggcgacaccacg Protospacer
** ****.*.**************
492. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gccgacgacgccggcgacggcgactgccgc Protospacer
* *****.** *************
493. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacgccgacggcgac------ Protospacer
** ****.***** **********
494. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gcgctatgcgacggcgacgccgacggcgac------ Protospacer
** ****.***** **********
495. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggtgacggcgacggcgacggcgaaggaccg Protospacer
*..********************
496. spacer 1.5|607081|30|NC_008711|CRT matches to LC473083 (Cutibacterium acnes TP-CU389 plasmid pTZC1 DNA, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gtcggcgtcgacggcgacggcgacggcccc Protospacer
* **.** ****************
497. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ggcatcggcgacggcgacggcgacggccga Protospacer
*.*. *******************
498. spacer 1.5|607081|30|NC_008711|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gaagacgacaacggcgacggcgacaccacg Protospacer
** ****.*.**************
499. spacer 1.5|607081|30|NC_008711|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gaagacgacaacggcgacggcgacaccacg Protospacer
** ****.*.**************
500. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---gacgaggacgacggcgacgacgacggccgc Protospacer
***** ****.**.**.*****.**.*
501. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---gacggcgacgacgtcgacggcgacgacgag Protospacer
****.*****.** **.**.**.****
502. spacer 1.5|607081|30|NC_008711|CRT matches to MN694776 (Marine virus AFVG_250M599, complete genome) position: , mismatch: 9, identity: 0.7
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gactacgacaacggcgacggcgacggatga Protospacer
*** ***.*.**************
503. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.667
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gccacctccgacggcgacggcaacggcgac------ Protospacer
* ****.*******.********
504. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gatcccgacgacggcgacggcgacggccca Protospacer
**. **.****************
505. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gatcccgacgacggcgacggcgacggccca Protospacer
**. **.****************
506. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac--- CRISPR spacer
---acccacgacgacggcgacggcggcgaccca Protospacer
. * ******.**.**.**.*******
507. spacer 1.5|607081|30|NC_008711|CRT matches to KT809302 (Haloarcula californiae icosahedral virus 1, complete genome) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------agcgacgacgacggcgacgacgaccaggag Protospacer
..*****.***********.****
508. spacer 1.5|607081|30|NC_008711|CRT matches to CP003955 (Rhodococcus opacus PD630 plasmid 6, complete sequence) position: , mismatch: 10, identity: 0.667
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gtactgctcgacggcgacggcgacggcgac------ Protospacer
. ****.****************
509. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------ctcgacgacgacggcgacggcaacgcgtcc Protospacer
*****.*************.**
510. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 10, identity: 0.667
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gactgctgcgacggcgacggcgatggcgat------ Protospacer
** ****.*********.*****.
511. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP035502 (Sphingosinicella sp. BN140058 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.667
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gatgacgacgacagagacggcgacgggcaa Protospacer
**.****.****.* *********
512. spacer 1.5|607081|30|NC_008711|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 11, identity: 0.633
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
ggcccgctggacggcgacagcgacggcgac------ Protospacer
. .****.****.***********
513. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 11, identity: 0.633
------tgagacgacgacggcgacggcgacggcgac CRISPR spacer
gggttgcgcgacggcgacggcgccggcgat------ Protospacer
.* ****.******** ******.
514. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 11, identity: 0.633
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------gtggacgacgacggcagcggcgacgggttg Protospacer
* ****.*******..*******
515. spacer 1.5|607081|30|NC_008711|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 12, identity: 0.6
tgagacgacgacggcgacggcgacggcgac------ CRISPR spacer
------atcaacgacgacgtctacggcgacggcctg Protospacer
. *.***.***** * ********
