Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_008726 Mycolicibacterium vanbaalenii PYR-1, complete sequence 7 crisprs csa3,cas3,WYL,c2c9_V-U4,RT,cas4,DEDDh,DinG 1 0 11 0

Results visualization

1. NC_008726
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_1 846784-846874 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_2 912184-912267 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_3 959137-959234 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_4 2440518-2440615 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_5 2694697-2694782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_6 2938891-2938985 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_008726_7 5468404-5468509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_008726_6 6.1|2938914|49|NC_008726|CRISPRCasFinder 2938914-2938962 49 NC_008726.1 2938878-2938926 0 1.0

1. spacer 6.1|2938914|49|NC_008726|CRISPRCasFinder matches to position: 2938878-2938926, mismatch: 0, identity: 1.0

tcgggaggcgccagccggacggcggcgaggattccgtcgggaggcgcca	CRISPR spacer
tcgggaggcgccagccggacggcggcgaggattccgtcgggaggcgcca	Protospacer
*************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 440506 : 554574 98 Mycobacterium_phage(20.0%) protease,transposase,integrase attL 492407:492423|attR 556264:556279
DBSCAN-SWA_2 590938 : 627495 29 Corynebacterium_phage(50.0%) transposase,integrase attL 590820:590879|attR 624325:625741
DBSCAN-SWA_3 1155371 : 1186116 21 Bacillus_virus(20.0%) transposase,integrase attL 1167075:1167090|attR 1194171:1194186
DBSCAN-SWA_4 2174860 : 2183822 9 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_5 2649719 : 2664597 20 Mycobacterium_phage(75.0%) capsid,integrase,transposase attL 2654899:2654922|attR 2666392:2666415
DBSCAN-SWA_6 2669723 : 2677199 8 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_7 3950287 : 3981765 24 Acinetobacter_phage(28.57%) protease,transposase NA
DBSCAN-SWA_8 4162830 : 4171715 6 Streptococcus_phage(100.0%) transposase,integrase attL 4164723:4164782|attR 4175125:4176421
DBSCAN-SWA_9 5746391 : 5811334 59 Tupanvirus(23.53%) protease,tRNA,integrase,holin attL 5785299:5785316|attR 5804817:5804834
DBSCAN-SWA_10 5876404 : 5932410 54 Paenibacillus_phage(11.11%) protease,transposase,integrase,holin attL 5876489:5876504|attR 5880710:5880725
DBSCAN-SWA_11 6294166 : 6383272 72 Mycobacterium_phage(25.0%) protease,transposase,integrase attL 6361090:6361111|attR 6370618:6370639
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage