Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009077 Mycobacterium sp. JLS, complete genome 3 crisprs cas3,csa3,casR,WYL,cas4,DEDDh,DinG 0 1 3 0

Results visualization

1. NC_009077
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009077_1 2523548-2523632 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009077_2 4951810-4951896 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009077_3 5881863-5881963 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009077_2 2.1|4951837|33|NC_009077|CRISPRCasFinder 4951837-4951869 33 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 348645-348677 7 0.788

1. spacer 2.1|4951837|33|NC_009077|CRISPRCasFinder matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.788

cccagcccgtcgtgccgagcgcccagcagaccg	CRISPR spacer
cgcgccccggcgtgccgcgcgcccagcagcgcg	Protospacer
* *. **** ******* ***********  **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1892661 : 1900387 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_2 2313268 : 2357956 31 Mycobacterium_phage(14.29%) integrase,transposase attL 2313059:2313082|attR 2369680:2369703
DBSCAN-SWA_3 4575375 : 4583561 10 Gordonia_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage