Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009431 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA03, complete sequence 0 crisprs NA 0 0 1 0
NC_009428 Rhodobacter sphaeroides ATCC 17025, complete genome 3 crisprs DEDDh,cas3,RT,csa3 1 1 10 0
NC_009432 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA04, complete sequence 0 crisprs NA 0 0 0 0
NC_009430 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence 0 crisprs NA 0 0 1 0
NC_009429 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 0 crisprs DEDDh,WYL,cas2,csa3 0 0 2 0
NC_009433 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA05, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. NC_009431
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10910 : 66723 50 Morganella_phage(18.18%) transposase,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009428
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009428_1 132429-132509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009428_2 1255177-1255248 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009428_3 1689851-1689958 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009428_2 2.1|1255204|18|NC_009428|CRISPRCasFinder 1255204-1255221 18 NC_009428.1 2321247-2321264 2 0.889
NC_009428_2 2.1|1255204|18|NC_009428|CRISPRCasFinder 1255204-1255221 18 NC_009428.1 2751237-2751254 2 0.889

1. spacer 2.1|1255204|18|NC_009428|CRISPRCasFinder matches to position: 2321247-2321264, mismatch: 2, identity: 0.889

cgtggtggtgcccgtcat	CRISPR spacer
cggggtggtgccggtcat	Protospacer
** ********* *****

2. spacer 2.1|1255204|18|NC_009428|CRISPRCasFinder matches to position: 2751237-2751254, mismatch: 2, identity: 0.889

cgtggtggtgcccgtcat	CRISPR spacer
cggggtggtgccggtcat	Protospacer
** ********* *****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009428_1 1.1|132456|27|NC_009428|CRISPRCasFinder 132456-132482 27 MK448898 Streptococcus phage Javan284, complete genome 33625-33651 6 0.778

1. spacer 1.1|132456|27|NC_009428|CRISPRCasFinder matches to MK448898 (Streptococcus phage Javan284, complete genome) position: , mismatch: 6, identity: 0.778

atctcctaaaatcgggtccgcaactcc	CRISPR spacer
ctctactaaaatcgggtccgctacatg	Protospacer
 *** **************** ** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 105662 : 142467 41 Stenotrophomonas_phage(18.18%) portal,capsid,head,terminase,integrase attL 118564:118582|attR 143353:143371
DBSCAN-SWA_2 424865 : 474442 50 uncultured_Mediterranean_phage(27.27%) tRNA,protease,transposase NA
DBSCAN-SWA_3 734888 : 752082 8 Bacillus_phage(50.0%) integrase,transposase attL 730331:730346|attR 760256:760271
DBSCAN-SWA_4 860980 : 870780 12 Vibrio_phage(16.67%) tRNA NA
DBSCAN-SWA_5 1103574 : 1115657 15 Paracoccus_phage(50.0%) protease,portal,tail,capsid,head NA
DBSCAN-SWA_6 1313513 : 1447540 148 Rhodobacter_phage(16.95%) protease,portal,tail,capsid,head,tRNA,terminase,integrase,transposase attL 1386198:1386239|attR 1403231:1403272
DBSCAN-SWA_7 1463931 : 1515882 50 Bacillus_phage(37.5%) tRNA,protease,transposase NA
DBSCAN-SWA_8 1767787 : 1799435 51 Rhodobacter_phage(41.67%) portal,tail,capsid,head,terminase,integrase attL 1770099:1770143|attR 1807408:1807452
DBSCAN-SWA_9 1845386 : 1870786 23 Bacillus_phage(25.0%) transposase NA
DBSCAN-SWA_10 2122461 : 2159351 48 Rhodobacter_phage(29.41%) head,terminase,integrase,transposase attL 2126924:2126940|attR 2166641:2166657
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_009430
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37867 : 76231 28 Wolbachia_phage(28.57%) transposase,integrase attL 18081:18096|attR 46914:46929
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_009429
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 327348 : 448267 83 Leptospira_phage(16.0%) transposase NA
DBSCAN-SWA_2 600655 : 675530 63 Stx2-converting_phage(29.17%) protease,integrase,transposase attL 669735:669794|attR 693533:693718
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. NC_009433
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 143 : 7366 9 Stx2-converting_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage