Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009466 Clostridium kluyveri DSM 555 plasmid pCKL555A, complete sequence 0 crisprs DEDDh 0 0 1 0
NC_009706 Clostridium kluyveri DSM 555, complete sequence 6 crisprs cas3,WYL,csa3,RT,DEDDh,cas14j,PD-DExK,PrimPol,cas2,cas1,cas4,cas5,cas7b,cas8b1,cas6,c2c9_V-U4 1 12 10 0

Results visualization

1. NC_009466
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17408 : 57061 43 Clostridium_phage(57.69%) tail,holin,terminase,protease,capsid,portal,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009706
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_1 1304343-1304444 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_2 2367160-2367909 Orphan III-B
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_3 2822947-2823765 TypeI-B III-B
12 spacers
cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_4 2825194-2825615 TypeI-B III-B
6 spacers
cas2,cas1,cas4,cas3,cas5,cas7b,cas8b1,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_5 2835088-2836691 TypeI-B III-B:NA
24 spacers
cas6,cas8b1,cas7b,cas5,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009706_6 3578641-3579856 Orphan III-B
18 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009706_3 3.11|2823634|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2823634-2823669 36 NC_009706.1 453439-453474 0 1.0

1. spacer 3.11|2823634|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to position: 453439-453474, mismatch: 0, identity: 1.0

tttccgaggaagaccaatgtccccttcggtattttg	CRISPR spacer
tttccgaggaagaccaatgtccccttcggtattttg	Protospacer
************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009706_2 2.1|2367190|36|NC_009706|CRISPRCasFinder,CRT 2367190-2367225 36 NZ_CP018336 Clostridium kluyveri strain JZZ plasmid unnamed, complete sequence 17489-17524 1 0.972
NC_009706_5 5.1|2835118|27|NC_009706|CRISPRCasFinder 2835118-2835144 27 AP014331 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS *** 16717-16743 5 0.815
NC_009706_5 5.1|2835118|27|NC_009706|CRISPRCasFinder 2835118-2835144 27 MN693180 Marine virus AFVG_25M318, complete genome 12880-12906 5 0.815
NC_009706_4 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 2825485-2825518 34 NC_013940 Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence 249280-249313 6 0.824
NC_009706_5 5.1|2835118|27|NC_009706|CRISPRCasFinder 2835118-2835144 27 NZ_CP010123 Escherichia coli strain C5 plasmid A, complete genome 135983-136009 6 0.778
NC_009706_5 5.1|2835118|27|NC_009706|CRISPRCasFinder 2835118-2835144 27 MF403008 Agrobacterium phage Atu_ph07, complete genome 321420-321446 6 0.778
NC_009706_5 5.1|2835118|27|NC_009706|CRISPRCasFinder 2835118-2835144 27 NZ_CP026690 Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM8, complete sequence 27067-27093 6 0.778
NC_009706_5 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR 2836627-2836661 35 MK250028 Prevotella phage Lak-B9, complete genome 515385-515419 7 0.8
NC_009706_5 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR 2836627-2836661 35 MK250027 Prevotella phage Lak-B8, complete genome 517029-517063 7 0.8
NC_009706_5 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR 2836627-2836661 35 MK250026 Prevotella phage Lak-B7, complete genome 516060-516094 7 0.8
NC_009706_5 5.25|2835111|34|NC_009706|CRT 2835111-2835144 34 NZ_CP021438 Bacillus thuringiensis strain C15 plasmid pBMB172, complete sequence 130021-130054 7 0.794
NC_009706_4 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 2825485-2825518 34 NC_020292 Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence 42490-42523 8 0.765
NC_009706_5 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR 2836033-2836066 34 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 629619-629652 8 0.765
NC_009706_5 5.25|2835111|34|NC_009706|CRT 2835111-2835144 34 AP014331 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS *** 16717-16750 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 67487-67520 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 150626-150659 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 36620-36653 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 211865-211898 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 3653-3686 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 136079-136112 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NC_025146 Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111 24381-24414 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 90994-91027 8 0.765
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 21132-21165 8 0.765
NC_009706_5 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR 2836033-2836066 34 MN693675 Marine virus AFVG_250M630, complete genome 13333-13366 9 0.735
NC_009706_5 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR 2836033-2836066 34 MN693578 Marine virus AFVG_25M520, complete genome 13571-13604 9 0.735
NC_009706_5 5.17|2836164|34|NC_009706|CRISPRCasFinder,PILER-CR 2836164-2836197 34 NZ_CP017199 Leuconostoc gelidum subsp. gasicomitatum strain TMW 2.1619 plasmid pL21619-2, complete genome 625-658 9 0.735
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 DQ535032 Lactococcus lactis phage KSY1, complete genome 26781-26814 9 0.735
NC_009706_6 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579727-3579760 34 NC_009817 Lactococcus phage KSY1, complete genome 26781-26814 9 0.735
NC_009706_2 2.4|2367385|35|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2367385-2367419 35 NZ_CP035936 Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence 47002-47036 10 0.714
NC_009706_2 2.4|2367385|35|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2367385-2367419 35 CP040041 Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence 274743-274777 10 0.714
NC_009706_2 2.8|2367648|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2367648-2367683 36 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 152984-153019 10 0.722
NC_009706_2 2.8|2367648|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2367648-2367683 36 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 229164-229199 10 0.722
NC_009706_4 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 2825485-2825518 34 MG869623 Polaromonas sp. W10N plasmid pW10NP1, complete sequence 2521-2554 10 0.706
NC_009706_4 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT 2825485-2825518 34 NZ_CP022346 Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence 105153-105186 10 0.706
NC_009706_5 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR 2836033-2836066 34 NZ_CP053316 Bacillus circulans strain GN03 plasmid unnamed, complete sequence 149754-149787 10 0.706
NC_009706_6 6.12|3579399|36|NC_009706|PILER-CR,CRISPRCasFinder,CRT 3579399-3579434 36 NZ_CP015325 Bacillus filamentosus strain Hbe603 plasmid pBEH3, complete sequence 84187-84222 10 0.722
NC_009706_2 2.11|2367844|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR 2367844-2367879 36 NZ_CP015111 Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence 269568-269603 11 0.694

1. spacer 2.1|2367190|36|NC_009706|CRISPRCasFinder,CRT matches to NZ_CP018336 (Clostridium kluyveri strain JZZ plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.972

aagcagtaaagataaatctttaaggattaaaaatgg	CRISPR spacer
aagcagtaaagataaatctttaaggattgaaaatgg	Protospacer
****************************.*******

2. spacer 5.1|2835118|27|NC_009706|CRISPRCasFinder matches to AP014331 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.815

ataaatttaaacatttaccattaaaat	CRISPR spacer
taaaatttaaaaatttacaattaaaaa	Protospacer
  ********* ****** ******* 

3. spacer 5.1|2835118|27|NC_009706|CRISPRCasFinder matches to MN693180 (Marine virus AFVG_25M318, complete genome) position: , mismatch: 5, identity: 0.815

ataaatttaaacatttaccattaaaat	CRISPR spacer
gtaagtttaaacatttacgattaatgt	Protospacer
.***.************* ***** .*

4. spacer 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_013940 (Deferribacter desulfuricans SSM1 megaplasmid pDF308, complete sequence) position: , mismatch: 6, identity: 0.824

ccaaggatttaatagaagaaatacataatttaga	CRISPR spacer
taaataatttaatggaagaaatacaaaatttaga	Protospacer
. ** .*******.*********** ********

5. spacer 5.1|2835118|27|NC_009706|CRISPRCasFinder matches to NZ_CP010123 (Escherichia coli strain C5 plasmid A, complete genome) position: , mismatch: 6, identity: 0.778

ataaatttaaacatttaccattaaaat	CRISPR spacer
taaaatttaaacatttaatattaaata	Protospacer
  *************** .******  

6. spacer 5.1|2835118|27|NC_009706|CRISPRCasFinder matches to MF403008 (Agrobacterium phage Atu_ph07, complete genome) position: , mismatch: 6, identity: 0.778

ataaatttaaacatttaccattaaaat	CRISPR spacer
tccaaattaaacatttaccattaataa	Protospacer
 . ** ****************** * 

7. spacer 5.1|2835118|27|NC_009706|CRISPRCasFinder matches to NZ_CP026690 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM8, complete sequence) position: , mismatch: 6, identity: 0.778

ataaatttaaacatttaccattaaaat-----	CRISPR spacer
gtaaatttaaacatttacc-----aatttcca	Protospacer
.******************     ***     

8. spacer 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 7, identity: 0.8

taaatagtaaaaattataaaaattgaatacgttca	CRISPR spacer
gaaatagaaaaaattataaaaaatgaataattttt	Protospacer
 ****** ************** ******  **. 

9. spacer 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 7, identity: 0.8

taaatagtaaaaattataaaaattgaatacgttca	CRISPR spacer
gaaatagaaaaaattataaaaaatgaataattttt	Protospacer
 ****** ************** ******  **. 

10. spacer 5.24|2836627|35|NC_009706|CRISPRCasFinder,PILER-CR matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 7, identity: 0.8

taaatagtaaaaattataaaaattgaatacgttca	CRISPR spacer
gaaatagaaaaaattataaaaaatgaataattttt	Protospacer
 ****** ************** ******  **. 

11. spacer 5.25|2835111|34|NC_009706|CRT matches to NZ_CP021438 (Bacillus thuringiensis strain C15 plasmid pBMB172, complete sequence) position: , mismatch: 7, identity: 0.794

gttcaacataaatttaaacatttac---cattaaaat	CRISPR spacer
tttcaacctaaatttaaacatgtacttacactaa---	Protospacer
 ****** ************* ***   **.***   

12. spacer 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_020292 (Clostridium saccharoperbutylacetonicum N1-4(HMT) plasmid Csp_135p, complete sequence) position: , mismatch: 8, identity: 0.765

ccaaggattt------aatagaagaaatacataatttaga	CRISPR spacer
------atttagaggaaatagaagaattaaataatttaga	Protospacer
      ****      ********** ** **********

13. spacer 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 8, identity: 0.765

ctatgttttttatctttgtgtttaat-tcctctac	CRISPR spacer
ttatcttttttatctttttgtttaatattagata-	Protospacer
.*** ************ ******** *.   ** 

14. spacer 5.25|2835111|34|NC_009706|CRT matches to AP014331 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S36-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.765

-gttcaacataaatttaaacatttaccattaaaat	CRISPR spacer
tcttctgta-aaatttaaaaatttacaattaaaaa	Protospacer
  *** ..* ********* ****** ******* 

15. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

16. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

17. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

18. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

19. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

20. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

21. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_025146 (Clostridium botulinum plasmid pCB111 DNA, complete sequence, strain: 111) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

22. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

23. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 8, identity: 0.765

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
actataatatatataatttacggaggtaattaaa	Protospacer
 .*. **  *********** ***** *******

24. spacer 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR matches to MN693675 (Marine virus AFVG_250M630, complete genome) position: , mismatch: 9, identity: 0.735

ctatgttttttatctttgtgtttaattcctctac	CRISPR spacer
ttctgttttttatttttgggtttaattcaaaaaa	Protospacer
.* **********.**** *********    * 

25. spacer 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR matches to MN693578 (Marine virus AFVG_25M520, complete genome) position: , mismatch: 9, identity: 0.735

ctatgttttttatctttgtgtttaattcctctac	CRISPR spacer
ttctgttttttatttttgggtttaattcaaaaaa	Protospacer
.* **********.**** *********    * 

26. spacer 5.17|2836164|34|NC_009706|CRISPRCasFinder,PILER-CR matches to NZ_CP017199 (Leuconostoc gelidum subsp. gasicomitatum strain TMW 2.1619 plasmid pL21619-2, complete genome) position: , mismatch: 9, identity: 0.735

cctagttgg------gttattaatgcctcctttttctttt	CRISPR spacer
------tggcaaaatgttattaatgcctattttttctttc	Protospacer
      ***      ************* .*********.

27. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to DQ535032 (Lactococcus lactis phage KSY1, complete genome) position: , mismatch: 9, identity: 0.735

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
gtctaattatatataatttaaggagaaaattaaa	Protospacer
 *. .*   ***********.****.********

28. spacer 6.17|3579727|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NC_009817 (Lactococcus phage KSY1, complete genome) position: , mismatch: 9, identity: 0.735

tttggaaattatataatttagggaggaaattaaa	CRISPR spacer
gtctaattatatataatttaaggagaaaattaaa	Protospacer
 *. .*   ***********.****.********

29. spacer 2.4|2367385|35|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035936 (Acinetobacter cumulans strain WCHAc060092 plasmid p1_060092, complete sequence) position: , mismatch: 10, identity: 0.714

aattaccaatatttttacctaaagtttttaatctt	CRISPR spacer
catcaccaatatttttacctaatgtttcagcatct	Protospacer
 **.****************** ****. .  ..*

30. spacer 2.4|2367385|35|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to CP040041 (Acinetobacter baumannii strain VB958 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

aattaccaatatttttacctaaagtttttaatctt	CRISPR spacer
catcaccaatatttttacctaatgtttcagcatct	Protospacer
 **.****************** ****. .  ..*

31. spacer 2.8|2367648|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 10, identity: 0.722

cagcaaagattatggaattataaggaggaaatttaa	CRISPR spacer
aattatgatttatggaagtataaggaggaaagttat	Protospacer
 * .* .. ******** ************* *** 

32. spacer 2.8|2367648|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 10, identity: 0.722

cagcaaagattatggaattataaggaggaaatttaa	CRISPR spacer
aattatgatttatggaagtataaggaggaaagttat	Protospacer
 * .* .. ******** ************* *** 

33. spacer 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to MG869623 (Polaromonas sp. W10N plasmid pW10NP1, complete sequence) position: , mismatch: 10, identity: 0.706

ccaaggatttaatagaagaaatacataatttaga	CRISPR spacer
ggttgcatttaatagaagaaatagatattttgac	Protospacer
    * ***************** *** ***.. 

34. spacer 4.5|2825485|34|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022346 (Bacillus thuringiensis strain c25 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ccaaggatttaatagaagaaatacataatttaga	CRISPR spacer
ttcattaaataatagaagaaactcataatttagt	Protospacer
.. *  *  ************. ********** 

35. spacer 5.15|2836033|34|NC_009706|CRISPRCasFinder,PILER-CR matches to NZ_CP053316 (Bacillus circulans strain GN03 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.706

ctatgttttttatctttgtgtttaattcctctac	CRISPR spacer
gatcctgatttatctttctgtttatttcctctat	Protospacer
   . *  ********* ****** ********.

36. spacer 6.12|3579399|36|NC_009706|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015325 (Bacillus filamentosus strain Hbe603 plasmid pBEH3, complete sequence) position: , mismatch: 10, identity: 0.722

ggtaattcagtttctacaactccacattcttttata	CRISPR spacer
tcttcttcagttgctacaactccagattcttggctt	Protospacer
  *  ******* *********** ******   * 

37. spacer 2.11|2367844|36|NC_009706|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015111 (Acinetobacter sp. TGL-Y2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.694

ctaggatatgcatttttattctttttaataattctt	CRISPR spacer
agtaaaaatgcatttttattctttttagcaatttcc	Protospacer
   ..* ********************..****...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1763809 : 1815505 53 uncultured_Caudovirales_phage(25.0%) coat,transposase NA
DBSCAN-SWA_2 1932641 : 1989077 89 Clostridium_phage(38.3%) tail,terminase,portal,plate NA
DBSCAN-SWA_3 2006988 : 2057333 81 Clostridium_phage(34.09%) plate,terminase,portal,tail NA
DBSCAN-SWA_4 2671759 : 2747920 81 Erysipelothrix_phage(62.96%) protease,portal,terminase,head,capsid,integrase,tail,holin,transposase attL 2666243:2666258|attR 2745296:2745311
DBSCAN-SWA_5 2752019 : 2764089 12 Synechococcus_phage(25.0%) NA NA
DBSCAN-SWA_6 2928913 : 2966199 38 Clostridium_phage(30.0%) terminase,integrase,transposase attL 2952993:2953010|attR 2967746:2967763
DBSCAN-SWA_7 2982682 : 3014942 40 Bacillus_phage(27.27%) capsid,integrase,terminase,transposase attL 2982502:2982547|attR 3018658:3018703
DBSCAN-SWA_8 3090305 : 3096039 6 Bacillus_phage(66.67%) NA NA
DBSCAN-SWA_9 3149650 : 3196965 39 Tupanvirus(20.0%) integrase,tRNA,transposase attL 3144421:3144437|attR 3171795:3171811
DBSCAN-SWA_10 3288354 : 3357786 93 uncultured_Caudovirales_phage(33.33%) portal,terminase,capsid,tail,tRNA,plate,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage