Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009473 Acidiphilium cryptum JF-5 plasmid pACRY07, complete sequence 0 crisprs NA 0 0 0 0
NC_009472 Acidiphilium cryptum JF-5 plasmid pACRY06, complete sequence 0 crisprs NA 0 0 0 0
NC_009469 Acidiphilium cryptum JF-5 plasmid pACRY03, complete sequence 0 crisprs NA 0 0 1 0
NC_009484 Acidiphilium cryptum JF-5, complete genome 2 crisprs csa3,cas3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,DEDDh 3 17 3 0
NC_009471 Acidiphilium cryptum JF-5 plasmid pACRY05, complete sequence 0 crisprs NA 0 0 0 0
NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 1 crisprs c2c9_V-U4,cas14j,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3 0 74 2 0
NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 1 crisprs csa3 2 2 2 2
NC_009474 Acidiphilium cryptum JF-5 plasmid pACRY08, complete sequence 0 crisprs NA 0 0 0 0
NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 1 crisprs NA 0 8 1 0

Results visualization

1. NC_009468
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009468_1 35116-37523 TypeI-E I-E
39 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009468_1 1.1|35144|33|NC_009468|PILER-CR 35144-35176 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35144-35176 0 1.0
NC_009468_1 1.2|35205|33|NC_009468|PILER-CR 35205-35237 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35205-35237 0 1.0
NC_009468_1 1.3|35266|33|NC_009468|PILER-CR 35266-35298 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35266-35298 0 1.0
NC_009468_1 1.4|35327|33|NC_009468|PILER-CR 35327-35359 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35327-35359 0 1.0
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35388-35420 0 1.0
NC_009468_1 1.6|35449|33|NC_009468|PILER-CR 35449-35481 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35449-35481 0 1.0
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35510-35542 0 1.0
NC_009468_1 1.8|35571|33|NC_009468|PILER-CR 35571-35603 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35571-35603 0 1.0
NC_009468_1 1.9|35632|33|NC_009468|PILER-CR 35632-35664 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35632-35664 0 1.0
NC_009468_1 1.10|35693|33|NC_009468|PILER-CR 35693-35725 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35693-35725 0 1.0
NC_009468_1 1.11|35754|33|NC_009468|PILER-CR 35754-35786 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35754-35786 0 1.0
NC_009468_1 1.12|35815|33|NC_009468|PILER-CR 35815-35847 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35815-35847 0 1.0
NC_009468_1 1.13|35876|33|NC_009468|PILER-CR 35876-35908 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35876-35908 0 1.0
NC_009468_1 1.14|35937|33|NC_009468|PILER-CR 35937-35969 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35937-35969 0 1.0
NC_009468_1 1.15|35998|33|NC_009468|PILER-CR 35998-36030 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35998-36030 0 1.0
NC_009468_1 1.16|36059|33|NC_009468|PILER-CR 36059-36091 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36059-36091 0 1.0
NC_009468_1 1.17|36120|33|NC_009468|PILER-CR 36120-36152 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36120-36152 0 1.0
NC_009468_1 1.18|36181|33|NC_009468|PILER-CR 36181-36213 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36181-36213 0 1.0
NC_009468_1 1.19|36242|33|NC_009468|PILER-CR 36242-36274 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36242-36274 0 1.0
NC_009468_1 1.20|36303|33|NC_009468|PILER-CR 36303-36335 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36303-36335 0 1.0
NC_009468_1 1.21|36364|33|NC_009468|PILER-CR 36364-36396 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36364-36396 0 1.0
NC_009468_1 1.22|36425|33|NC_009468|PILER-CR 36425-36457 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36425-36457 0 1.0
NC_009468_1 1.23|36486|33|NC_009468|PILER-CR 36486-36518 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36486-36518 0 1.0
NC_009468_1 1.24|36547|33|NC_009468|PILER-CR 36547-36579 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36547-36579 0 1.0
NC_009468_1 1.25|36608|33|NC_009468|PILER-CR 36608-36640 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36608-36640 0 1.0
NC_009468_1 1.26|36669|33|NC_009468|PILER-CR 36669-36701 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36669-36701 0 1.0
NC_009468_1 1.27|36730|33|NC_009468|PILER-CR 36730-36762 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36730-36762 0 1.0
NC_009468_1 1.28|36791|33|NC_009468|PILER-CR 36791-36823 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36791-36823 0 1.0
NC_009468_1 1.29|36852|33|NC_009468|PILER-CR 36852-36884 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36852-36884 0 1.0
NC_009468_1 1.30|36913|33|NC_009468|PILER-CR 36913-36945 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36913-36945 0 1.0
NC_009468_1 1.31|36974|33|NC_009468|PILER-CR 36974-37006 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36974-37006 0 1.0
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37035-37067 0 1.0
NC_009468_1 1.33|37096|33|NC_009468|PILER-CR 37096-37128 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37096-37128 0 1.0
NC_009468_1 1.34|37157|33|NC_009468|PILER-CR 37157-37189 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37157-37189 0 1.0
NC_009468_1 1.35|37218|33|NC_009468|PILER-CR 37218-37250 33 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37218-37250 0 1.0
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35145-35176 0 1.0
NC_009468_1 1.37|35206|32|NC_009468|CRISPRCasFinder,CRT 35206-35237 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35206-35237 0 1.0
NC_009468_1 1.38|35267|32|NC_009468|CRISPRCasFinder,CRT 35267-35298 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35267-35298 0 1.0
NC_009468_1 1.39|35328|32|NC_009468|CRISPRCasFinder,CRT 35328-35359 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35328-35359 0 1.0
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35389-35420 0 1.0
NC_009468_1 1.41|35450|32|NC_009468|CRISPRCasFinder,CRT 35450-35481 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35450-35481 0 1.0
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35511-35542 0 1.0
NC_009468_1 1.43|35572|32|NC_009468|CRISPRCasFinder,CRT 35572-35603 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35572-35603 0 1.0
NC_009468_1 1.44|35633|32|NC_009468|CRISPRCasFinder,CRT 35633-35664 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35633-35664 0 1.0
NC_009468_1 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT 35694-35725 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35694-35725 0 1.0
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35755-35786 0 1.0
NC_009468_1 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT 35816-35847 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35816-35847 0 1.0
NC_009468_1 1.48|35877|32|NC_009468|CRISPRCasFinder,CRT 35877-35908 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35877-35908 0 1.0
NC_009468_1 1.49|35938|32|NC_009468|CRISPRCasFinder,CRT 35938-35969 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35938-35969 0 1.0
NC_009468_1 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT 35999-36030 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 35999-36030 0 1.0
NC_009468_1 1.51|36060|32|NC_009468|CRISPRCasFinder,CRT 36060-36091 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36060-36091 0 1.0
NC_009468_1 1.52|36121|32|NC_009468|CRISPRCasFinder,CRT 36121-36152 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36121-36152 0 1.0
NC_009468_1 1.53|36182|32|NC_009468|CRISPRCasFinder,CRT 36182-36213 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36182-36213 0 1.0
NC_009468_1 1.54|36243|32|NC_009468|CRISPRCasFinder,CRT 36243-36274 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36243-36274 0 1.0
NC_009468_1 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT 36304-36335 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36304-36335 0 1.0
NC_009468_1 1.56|36365|32|NC_009468|CRISPRCasFinder,CRT 36365-36396 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36365-36396 0 1.0
NC_009468_1 1.57|36426|32|NC_009468|CRISPRCasFinder,CRT 36426-36457 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36426-36457 0 1.0
NC_009468_1 1.58|36487|32|NC_009468|CRISPRCasFinder,CRT 36487-36518 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36487-36518 0 1.0
NC_009468_1 1.59|36548|32|NC_009468|CRISPRCasFinder,CRT 36548-36579 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36548-36579 0 1.0
NC_009468_1 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT 36609-36640 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36609-36640 0 1.0
NC_009468_1 1.61|36670|32|NC_009468|CRISPRCasFinder,CRT 36670-36701 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36670-36701 0 1.0
NC_009468_1 1.62|36731|32|NC_009468|CRISPRCasFinder,CRT 36731-36762 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36731-36762 0 1.0
NC_009468_1 1.63|36792|32|NC_009468|CRISPRCasFinder,CRT 36792-36823 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36792-36823 0 1.0
NC_009468_1 1.64|36853|32|NC_009468|CRISPRCasFinder,CRT 36853-36884 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36853-36884 0 1.0
NC_009468_1 1.65|36914|32|NC_009468|CRISPRCasFinder,CRT 36914-36945 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36914-36945 0 1.0
NC_009468_1 1.66|36975|32|NC_009468|CRISPRCasFinder,CRT 36975-37006 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 36975-37006 0 1.0
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37036-37067 0 1.0
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37097-37128 0 1.0
NC_009468_1 1.69|37158|32|NC_009468|CRISPRCasFinder,CRT 37158-37189 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37158-37189 0 1.0
NC_009468_1 1.70|37219|32|NC_009468|CRISPRCasFinder,CRT 37219-37250 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37219-37250 0 1.0
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37280-37311 0 1.0
NC_009468_1 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT 37341-37372 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37341-37372 0 1.0
NC_009468_1 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT 37402-37433 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37402-37433 0 1.0
NC_009468_1 1.74|37463|32|NC_009468|CRISPRCasFinder,CRT 37463-37494 32 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 37463-37494 0 1.0
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP015246 Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence 42859-42890 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP031907 Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence 22669-22700 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 CP042949 Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence 73720-73751 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP028431 Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence 1818-1849 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP028118 Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence 31724-31755 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP021341 Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence 69764-69795 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP021337 Escherichia coli strain 95JB1 plasmid p95JB1B, complete sequence 71044-71075 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP029691 Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence 1818-1849 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027463 Escherichia coli isolate 07-4299 plasmid unnamed 56811-56842 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027767 Escherichia coli strain 2013C-3342 plasmid unnamed, complete sequence 26554-26585 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_AP018805 Escherichia coli strain E2863 plasmid pE2863-3, complete sequence 61353-61384 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027311 Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence 44743-44774 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027576 Escherichia coli strain 2013C-4081 plasmid unnamed3, complete sequence 48545-48576 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027458 Escherichia coli strain 88-3493 plasmid unnamed, complete sequence 76065-76096 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027553 Escherichia coli strain 2015C-4498 plasmid unnamed, complete sequence 47850-47881 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP027367 Escherichia coli strain 89-3156 plasmid unnamed, complete sequence 52973-53004 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP028434 Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence 1818-1849 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_AP019763 Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence 61388-61419 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP024291 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence 61056-61087 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP023164 Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence 41364-41395 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_AP018800 Escherichia coli strain E2855 plasmid pE2855-4, complete sequence 62610-62641 6 0.812
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NC_013366 Escherichia coli O111:H- str. 11128 plasmid pO111_3, complete sequence 15407-15438 6 0.812
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP010729 Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence 39282-39313 6 0.812
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 45136-45167 6 0.812
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 95416-95448 7 0.788
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 CP054927 Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence 45135-45167 7 0.788
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 43466-43497 7 0.781
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 52958-52989 7 0.781
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 95416-95447 7 0.781
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 32165-32196 7 0.781
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 17230-17261 7 0.781
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NC_020563 Sphingomonas sp. MM-1 plasmid pISP4, complete sequence 32094-32125 7 0.781
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP005087 Sphingobium sp. TKS plasmid pTK3, complete sequence 28018-28049 7 0.781
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 160547-160578 7 0.781
NC_009468_1 1.64|36853|32|NC_009468|CRISPRCasFinder,CRT 36853-36884 32 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 12425-12456 7 0.781
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 986541-986572 7 0.781
NC_009468_1 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT 37402-37433 32 CP031731 Stenotrophomonas rhizophila strain GA1 plasmid unnamed2, complete sequence 36914-36945 7 0.781
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NZ_CP007735 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence 43465-43497 8 0.758
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 21604-21636 8 0.758
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 44736-44768 8 0.758
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 21415-21447 8 0.758
NC_009468_1 1.5|35388|33|NC_009468|PILER-CR 35388-35420 33 CP032292 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence 52957-52989 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_CP005192 Sphingobium sp. MI1205 plasmid pMI3, complete sequence 32165-32197 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_CP005087 Sphingobium sp. TKS plasmid pTK3, complete sequence 28018-28050 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NC_020562 Sphingomonas sp. MM-1 plasmid pISP1, complete sequence 160547-160579 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 MN813686 Mycobacterium phage BirdsNest, complete genome 44774-44806 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_CP005193 Sphingobium sp. MI1205 plasmid pMI4, complete sequence 17229-17261 8 0.758
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NC_020563 Sphingomonas sp. MM-1 plasmid pISP4, complete sequence 32093-32125 8 0.758
NC_009468_1 1.10|35693|33|NC_009468|PILER-CR 35693-35725 33 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 228796-228828 8 0.758
NC_009468_1 1.10|35693|33|NC_009468|PILER-CR 35693-35725 33 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 23353-23385 8 0.758
NC_009468_1 1.29|36852|33|NC_009468|PILER-CR 36852-36884 33 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 12424-12456 8 0.758
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 643959-643991 8 0.758
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 176101-176133 8 0.758
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP010598 Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence 21605-21636 8 0.75
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NC_018288 Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence 44736-44767 8 0.75
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 21416-21447 8 0.75
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 MN813686 Mycobacterium phage BirdsNest, complete genome 44774-44805 8 0.75
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 211552-211583 8 0.75
NC_009468_1 1.44|35633|32|NC_009468|CRISPRCasFinder,CRT 35633-35664 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 983184-983215 8 0.75
NC_009468_1 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT 35694-35725 32 NZ_CP007516 Rubrobacter radiotolerans strain RSPS-4 plasmid 2, complete sequence 58306-58337 8 0.75
NC_009468_1 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT 35694-35725 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 228796-228827 8 0.75
NC_009468_1 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT 35694-35725 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 23353-23384 8 0.75
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 15951-15982 8 0.75
NC_009468_1 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT 36304-36335 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 430619-430650 8 0.75
NC_009468_1 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT 36304-36335 32 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 380673-380704 8 0.75
NC_009468_1 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT 36304-36335 32 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 437207-437238 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 728111-728142 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 912935-912966 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 591988-592019 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP016083 Streptomyces sp. SAT1 plasmid unnamed3, complete sequence 643959-643990 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 176102-176133 8 0.75
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 MT270409 Phaeobacter phage MD18, complete genome 69047-69078 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 1398013-1398044 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 348544-348575 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 350257-350288 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 1358779-1358810 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 416081-416112 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 949639-949670 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1320742-1320773 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1378237-1378268 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 1600462-1600493 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1989938-1989969 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 55167-55198 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1566119-1566150 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 31442-31473 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 1286355-1286386 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 1249611-1249642 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 502134-502165 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 1302349-1302380 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1554779-1554810 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 1386643-1386674 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 558267-558298 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 345808-345839 8 0.75
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 348544-348575 8 0.75
NC_009468_1 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT 37341-37372 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 166339-166370 8 0.75
NC_009468_1 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT 37402-37433 32 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 260318-260349 8 0.75
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 211551-211583 9 0.727
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 44494-44526 9 0.727
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 209749-209781 9 0.727
NC_009468_1 1.9|35632|33|NC_009468|PILER-CR 35632-35664 33 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 983184-983216 9 0.727
NC_009468_1 1.10|35693|33|NC_009468|PILER-CR 35693-35725 33 NZ_CP007516 Rubrobacter radiotolerans strain RSPS-4 plasmid 2, complete sequence 58306-58338 9 0.727
NC_009468_1 1.11|35754|33|NC_009468|PILER-CR 35754-35786 33 KM389229 UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence 15950-15982 9 0.727
NC_009468_1 1.20|36303|33|NC_009468|PILER-CR 36303-36335 33 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 430619-430651 9 0.727
NC_009468_1 1.20|36303|33|NC_009468|PILER-CR 36303-36335 33 NZ_CP021128 Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence 380673-380705 9 0.727
NC_009468_1 1.20|36303|33|NC_009468|PILER-CR 36303-36335 33 CP007645 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence 437207-437239 9 0.727
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 912935-912967 9 0.727
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 728110-728142 9 0.727
NC_009468_1 1.32|37035|33|NC_009468|PILER-CR 37035-37067 33 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 591988-592020 9 0.727
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 394062-394093 9 0.719
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 MN586020 Microbacterium phage Megan, complete genome 15368-15399 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_GU811235 Sphingobium chungbukense strain DJ77 plasmid pSY3, complete sequence 14705-14736 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP044082 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence 44495-44526 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP031080 Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence 209750-209781 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 133159-133190 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 1855915-1855946 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_AP022849 Bosea sp. ANAM02 plasmid pANAM02, complete sequence 541100-541131 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 784812-784843 9 0.719
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 382588-382619 9 0.719
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 672556-672587 9 0.719
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 408419-408450 9 0.719
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 373167-373198 9 0.719
NC_009468_1 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT 35755-35786 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 672556-672587 9 0.719
NC_009468_1 1.54|36243|32|NC_009468|CRISPRCasFinder,CRT 36243-36274 32 NZ_CP047177 Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence 36086-36117 9 0.719
NC_009468_1 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT 36609-36640 32 NZ_CP013486 Vibrio alginolyticus strain ATCC 33787 plasmid pMBL128, complete sequence 4229-4260 9 0.719
NC_009468_1 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT 37036-37067 32 MG641885 Salmonella phage PMBT28, complete genome 11924-11955 9 0.719
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NZ_CP051517 Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1 10390-10421 9 0.719
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 783914-783945 9 0.719
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NZ_CP041223 Porphyrobacter sp. YT40 plasmid pYT40, complete sequence 139418-139449 9 0.719
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 MK310144 Mycobacterium phage CicholasNage, complete genome 26643-26674 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 KX388536 Agrobacterium tumefaciens strain Chry5 plasmid pTiChry5, complete sequence 81946-81977 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_KY000032 Agrobacterium fabrum strain CFBP2788 plasmid pTi_CFBP2788, complete sequence 64723-64754 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_KY000032 Agrobacterium fabrum strain CFBP2788 plasmid pTi_CFBP2788, complete sequence 79868-79899 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33873-33904 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 218697-218728 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 207168-207199 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_KY000074 Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence 95803-95834 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 207168-207199 9 0.719
NC_009468_1 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT 37280-37311 32 CP047390 Agrobacterium sp. CGMCC 11546 plasmid pB 48493-48524 9 0.719
NC_009468_1 1.7|35510|33|NC_009468|PILER-CR 35510-35542 33 NZ_GU811235 Sphingobium chungbukense strain DJ77 plasmid pSY3, complete sequence 14704-14736 10 0.697
NC_009468_1 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT 35145-35176 32 NZ_CP022416 Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence 292835-292866 10 0.688
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 101530-101561 10 0.688
NC_009468_1 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT 35389-35420 32 NZ_CP010860 Marinovum algicola DG 898 plasmid pMaD5, complete sequence 98252-98283 10 0.688
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_AP018668 Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence 5251-5282 10 0.688
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP018096 Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence 368303-368334 10 0.688
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 51729-51760 10 0.688
NC_009468_1 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT 35511-35542 32 MN478374 Bacteriophage Phobos, complete genome 29674-29705 10 0.688
NC_009468_1 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT 35816-35847 32 KU728633 Mycobacterium phage Bipper, complete genome 70372-70403 10 0.688
NC_009468_1 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT 35816-35847 32 MK977701 Mycobacterium phage Cracklewink, complete genome 69524-69555 10 0.688
NC_009468_1 1.48|35877|32|NC_009468|CRISPRCasFinder,CRT 35877-35908 32 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 139730-139761 10 0.688
NC_009468_1 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT 35999-36030 32 NZ_CP015041 Rhodovulum sp. P5 plasmid pRGUI02, complete sequence 53357-53388 10 0.688
NC_009468_1 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT 35999-36030 32 AP017627 Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome 94219-94250 10 0.688
NC_009468_1 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT 36609-36640 32 NZ_CP015420 Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence 10232-10263 10 0.688
NC_009468_1 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT 36609-36640 32 NZ_AP014801 Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351 76054-76085 10 0.688
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 409121-409152 10 0.688
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 139017-139048 10 0.688
NC_009468_1 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT 37097-37128 32 MH593834 Siphoviridae sp. isolate ctbe1, complete genome 57283-57314 10 0.688
NC_009468_1 1.69|37158|32|NC_009468|CRISPRCasFinder,CRT 37158-37189 32 NZ_LN614828 Legionella fallonii LLAP-10 plasmid II, complete sequence 233595-233626 10 0.688
NC_009468_1 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT 37341-37372 32 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1209657-1209688 10 0.688
NC_009468_1 1.65|36914|32|NC_009468|CRISPRCasFinder,CRT 36914-36945 32 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 26156-26187 11 0.656

1. spacer 1.1|35144|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gccgcctgggaggatatggagcgctggattgat	CRISPR spacer
gccgcctgggaggatatggagcgctggattgat	Protospacer
*********************************

2. spacer 1.2|35205|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggcggcgcaatactacgcagcggtgaaagc	CRISPR spacer
ggcggcggcgcaatactacgcagcggtgaaagc	Protospacer
*********************************

3. spacer 1.3|35266|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaaaatggcgttctgggaggcgctgacgaat	CRISPR spacer
gcgaaaatggcgttctgggaggcgctgacgaat	Protospacer
*********************************

4. spacer 1.4|35327|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gatgtggtggcaagtgacgggccgagtctggaa	CRISPR spacer
gatgtggtggcaagtgacgggccgagtctggaa	Protospacer
*********************************

5. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
gatgcgcaaggcgcgcaagcgcaagggcaacag	Protospacer
*********************************

6. spacer 1.6|35449|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggtcattgatctgtcgccagtggccgtcgtccg	CRISPR spacer
ggtcattgatctgtcgccagtggccgtcgtccg	Protospacer
*********************************

7. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gcttcgcgccctgatcgacatgcagcgcgaggt	Protospacer
*********************************

8. spacer 1.8|35571|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gatctccttgtctatctaaaaactagcacagag	CRISPR spacer
gatctccttgtctatctaaaaactagcacagag	Protospacer
*********************************

9. spacer 1.9|35632|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gttttttgaacagccggaattgattgaacagtt	CRISPR spacer
gttttttgaacagccggaattgattgaacagtt	Protospacer
*********************************

10. spacer 1.10|35693|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
gcgaatgaggaattcgccgcgttctatacgctc	Protospacer
*********************************

11. spacer 1.11|35754|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
gtgtcgcaatccggagtcggctcgctccgccat	Protospacer
*********************************

12. spacer 1.12|35815|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggggtatacgtgctaccggcgggggctggagta	CRISPR spacer
ggggtatacgtgctaccggcgggggctggagta	Protospacer
*********************************

13. spacer 1.13|35876|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggccgatgctcgcgcagaaagtgggcgtgtg	CRISPR spacer
gtggccgatgctcgcgcagaaagtgggcgtgtg	Protospacer
*********************************

14. spacer 1.14|35937|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gccgtcaaatcgatggagcccggtcactgttgt	CRISPR spacer
gccgtcaaatcgatggagcccggtcactgttgt	Protospacer
*********************************

15. spacer 1.15|35998|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtaaagcgcggcgtccccccgcgccgcaaaagc	CRISPR spacer
gtaaagcgcggcgtccccccgcgccgcaaaagc	Protospacer
*********************************

16. spacer 1.16|36059|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggagcgcaagcacctggcgtcggagatttgggc	CRISPR spacer
ggagcgcaagcacctggcgtcggagatttgggc	Protospacer
*********************************

17. spacer 1.17|36120|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gggtggaagatggtttgtcattcgcagagccca	CRISPR spacer
gggtggaagatggtttgtcattcgcagagccca	Protospacer
*********************************

18. spacer 1.18|36181|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gccggaagggacgggctcgcatgccacgggcac	CRISPR spacer
gccggaagggacgggctcgcatgccacgggcac	Protospacer
*********************************

19. spacer 1.19|36242|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggcagaggcagcagagaggcgatgcaccgaatt	CRISPR spacer
ggcagaggcagcagagaggcgatgcaccgaatt	Protospacer
*********************************

20. spacer 1.20|36303|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
ggatatcgttgccagacggcgcacgctcgcaat	Protospacer
*********************************

21. spacer 1.21|36364|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gacagaccagaggaggcaagagagcgcgacagg	CRISPR spacer
gacagaccagaggaggcaagagagcgcgacagg	Protospacer
*********************************

22. spacer 1.22|36425|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gatcgtcgatctaacgacaccgccaacgatgtt	CRISPR spacer
gatcgtcgatctaacgacaccgccaacgatgtt	Protospacer
*********************************

23. spacer 1.23|36486|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gggcgccaacggttgcgtcttgtttctcgtcta	CRISPR spacer
gggcgccaacggttgcgtcttgtttctcgtcta	Protospacer
*********************************

24. spacer 1.24|36547|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggcggacccgctattactgacctggctcgatcg	CRISPR spacer
ggcggacccgctattactgacctggctcgatcg	Protospacer
*********************************

25. spacer 1.25|36608|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcgacgccggacgctcgcgaaatcgcctttgtg	CRISPR spacer
gcgacgccggacgctcgcgaaatcgcctttgtg	Protospacer
*********************************

26. spacer 1.26|36669|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gacgccggttcgcgggcgcacagtgcttgtgca	CRISPR spacer
gacgccggttcgcgggcgcacagtgcttgtgca	Protospacer
*********************************

27. spacer 1.27|36730|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gctcgccgggctgtggaagaaagccggcccctg	CRISPR spacer
gctcgccgggctgtggaagaaagccggcccctg	Protospacer
*********************************

28. spacer 1.28|36791|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgtgcagatcgtggttgacaatccaggcagc	CRISPR spacer
gtcgtgcagatcgtggttgacaatccaggcagc	Protospacer
*********************************

29. spacer 1.29|36852|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gccgttcgtctggatcgtagatcgcgaaatgac	CRISPR spacer
gccgttcgtctggatcgtagatcgcgaaatgac	Protospacer
*********************************

30. spacer 1.30|36913|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggattgtcaggtaatcgccgagcgtctgataaa	CRISPR spacer
ggattgtcaggtaatcgccgagcgtctgataaa	Protospacer
*********************************

31. spacer 1.31|36974|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgcttcgagcgccgccgggccacaaggttgt	CRISPR spacer
ggcgcttcgagcgccgccgggccacaaggttgt	Protospacer
*********************************

32. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
ggtgcggttctgcaccgggccgaacgtggccgc	Protospacer
*********************************

33. spacer 1.33|37096|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
gtcagcgtatcgctcgcggcggcaacgtgggta	Protospacer
*********************************

34. spacer 1.34|37157|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtttacgttgtattgggtgcggcgagacgggca	CRISPR spacer
gtttacgttgtattgggtgcggcgagacgggca	Protospacer
*********************************

35. spacer 1.35|37218|33|NC_009468|PILER-CR matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtcctgggtgagcgagacgggcacactcacggg	CRISPR spacer
gtcctgggtgagcgagacgggcacactcacggg	Protospacer
*********************************

36. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ccgcctgggaggatatggagcgctggattgat	CRISPR spacer
ccgcctgggaggatatggagcgctggattgat	Protospacer
********************************

37. spacer 1.37|35206|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcggcggcgcaatactacgcagcggtgaaagc	CRISPR spacer
gcggcggcgcaatactacgcagcggtgaaagc	Protospacer
********************************

38. spacer 1.38|35267|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

cgaaaatggcgttctgggaggcgctgacgaat	CRISPR spacer
cgaaaatggcgttctgggaggcgctgacgaat	Protospacer
********************************

39. spacer 1.39|35328|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

atgtggtggcaagtgacgggccgagtctggaa	CRISPR spacer
atgtggtggcaagtgacgggccgagtctggaa	Protospacer
********************************

40. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
atgcgcaaggcgcgcaagcgcaagggcaacag	Protospacer
********************************

41. spacer 1.41|35450|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtcattgatctgtcgccagtggccgtcgtccg	CRISPR spacer
gtcattgatctgtcgccagtggccgtcgtccg	Protospacer
********************************

42. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cttcgcgccctgatcgacatgcagcgcgaggt	Protospacer
********************************

43. spacer 1.43|35572|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

atctccttgtctatctaaaaactagcacagag	CRISPR spacer
atctccttgtctatctaaaaactagcacagag	Protospacer
********************************

44. spacer 1.44|35633|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ttttttgaacagccggaattgattgaacagtt	CRISPR spacer
ttttttgaacagccggaattgattgaacagtt	Protospacer
********************************

45. spacer 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

cgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
cgaatgaggaattcgccgcgttctatacgctc	Protospacer
********************************

46. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
tgtcgcaatccggagtcggctcgctccgccat	Protospacer
********************************

47. spacer 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gggtatacgtgctaccggcgggggctggagta	CRISPR spacer
gggtatacgtgctaccggcgggggctggagta	Protospacer
********************************

48. spacer 1.48|35877|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tggccgatgctcgcgcagaaagtgggcgtgtg	CRISPR spacer
tggccgatgctcgcgcagaaagtgggcgtgtg	Protospacer
********************************

49. spacer 1.49|35938|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ccgtcaaatcgatggagcccggtcactgttgt	CRISPR spacer
ccgtcaaatcgatggagcccggtcactgttgt	Protospacer
********************************

50. spacer 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

taaagcgcggcgtccccccgcgccgcaaaagc	CRISPR spacer
taaagcgcggcgtccccccgcgccgcaaaagc	Protospacer
********************************

51. spacer 1.51|36060|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gagcgcaagcacctggcgtcggagatttgggc	CRISPR spacer
gagcgcaagcacctggcgtcggagatttgggc	Protospacer
********************************

52. spacer 1.52|36121|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggtggaagatggtttgtcattcgcagagccca	CRISPR spacer
ggtggaagatggtttgtcattcgcagagccca	Protospacer
********************************

53. spacer 1.53|36182|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ccggaagggacgggctcgcatgccacgggcac	CRISPR spacer
ccggaagggacgggctcgcatgccacgggcac	Protospacer
********************************

54. spacer 1.54|36243|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcagaggcagcagagaggcgatgcaccgaatt	CRISPR spacer
gcagaggcagcagagaggcgatgcaccgaatt	Protospacer
********************************

55. spacer 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
gatatcgttgccagacggcgcacgctcgcaat	Protospacer
********************************

56. spacer 1.56|36365|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

acagaccagaggaggcaagagagcgcgacagg	CRISPR spacer
acagaccagaggaggcaagagagcgcgacagg	Protospacer
********************************

57. spacer 1.57|36426|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

atcgtcgatctaacgacaccgccaacgatgtt	CRISPR spacer
atcgtcgatctaacgacaccgccaacgatgtt	Protospacer
********************************

58. spacer 1.58|36487|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ggcgccaacggttgcgtcttgtttctcgtcta	CRISPR spacer
ggcgccaacggttgcgtcttgtttctcgtcta	Protospacer
********************************

59. spacer 1.59|36548|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcggacccgctattactgacctggctcgatcg	CRISPR spacer
gcggacccgctattactgacctggctcgatcg	Protospacer
********************************

60. spacer 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

cgacgccggacgctcgcgaaatcgcctttgtg	CRISPR spacer
cgacgccggacgctcgcgaaatcgcctttgtg	Protospacer
********************************

61. spacer 1.61|36670|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

acgccggttcgcgggcgcacagtgcttgtgca	CRISPR spacer
acgccggttcgcgggcgcacagtgcttgtgca	Protospacer
********************************

62. spacer 1.62|36731|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ctcgccgggctgtggaagaaagccggcccctg	CRISPR spacer
ctcgccgggctgtggaagaaagccggcccctg	Protospacer
********************************

63. spacer 1.63|36792|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tcgtgcagatcgtggttgacaatccaggcagc	CRISPR spacer
tcgtgcagatcgtggttgacaatccaggcagc	Protospacer
********************************

64. spacer 1.64|36853|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

ccgttcgtctggatcgtagatcgcgaaatgac	CRISPR spacer
ccgttcgtctggatcgtagatcgcgaaatgac	Protospacer
********************************

65. spacer 1.65|36914|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gattgtcaggtaatcgccgagcgtctgataaa	CRISPR spacer
gattgtcaggtaatcgccgagcgtctgataaa	Protospacer
********************************

66. spacer 1.66|36975|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gcgcttcgagcgccgccgggccacaaggttgt	CRISPR spacer
gcgcttcgagcgccgccgggccacaaggttgt	Protospacer
********************************

67. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
gtgcggttctgcaccgggccgaacgtggccgc	Protospacer
********************************

68. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
tcagcgtatcgctcgcggcggcaacgtgggta	Protospacer
********************************

69. spacer 1.69|37158|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tttacgttgtattgggtgcggcgagacgggca	CRISPR spacer
tttacgttgtattgggtgcggcgagacgggca	Protospacer
********************************

70. spacer 1.70|37219|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tcctgggtgagcgagacgggcacactcacggg	CRISPR spacer
tcctgggtgagcgagacgggcacactcacggg	Protospacer
********************************

71. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
tccggcatcgtttccgcgccggcattcacgcc	Protospacer
********************************

72. spacer 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

cctgacaccggcgacacggccctcagccgctc	CRISPR spacer
cctgacaccggcgacacggccctcagccgctc	Protospacer
********************************

73. spacer 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

aacgtgacaacgcccgtcgcctgcgcggtgag	CRISPR spacer
aacgtgacaacgcccgtcgcctgcgcggtgag	Protospacer
********************************

74. spacer 1.74|37463|32|NC_009468|CRISPRCasFinder,CRT matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

acgcgggggcttcgataggcttggtaagcttc	CRISPR spacer
acgcgggggcttcgataggcttggtaagcttc	Protospacer
********************************

75. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP015246 (Escherichia coli O91 str. RM7190 plasmid pRM7190-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

76. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP031907 (Escherichia coli O91:H21 strain FWSEC0008 plasmid unnamed17, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

77. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to CP042949 (Escherichia coli strain ATCC 51435 plasmid pB2F1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

78. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP028431 (Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

79. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP028118 (Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

80. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021341 (Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

81. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021337 (Escherichia coli strain 95JB1 plasmid p95JB1B, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

82. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP029691 (Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

83. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027463 (Escherichia coli isolate 07-4299 plasmid unnamed) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

84. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027767 (Escherichia coli strain 2013C-3342 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

85. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP018805 (Escherichia coli strain E2863 plasmid pE2863-3, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

86. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027311 (Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

87. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027576 (Escherichia coli strain 2013C-4081 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

88. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

89. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027553 (Escherichia coli strain 2015C-4498 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

90. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP027367 (Escherichia coli strain 89-3156 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

91. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP028434 (Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

92. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP019763 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

93. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP024291 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

94. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP023164 (Escherichia coli O22:H8 strain RM10809-3 plasmid pRM10809-3, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

95. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP018800 (Escherichia coli strain E2855 plasmid pE2855-4, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

96. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NC_013366 (Escherichia coli O111:H- str. 11128 plasmid pO111_3, complete sequence) position: , mismatch: 6, identity: 0.812

ccgcctgggaggatatggagcgctgg-attgat	CRISPR spacer
tggcctggcaggataaggagcgctgacattga-	Protospacer
. ****** ****** *********. ***** 

97. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP010729 (Phaeobacter inhibens strain P88 plasmid pP88_d, complete sequence) position: , mismatch: 6, identity: 0.812

cttcgcgccctgatcgacatgcagcgcgaggt-	CRISPR spacer
tttcgcggcctgatcgacatgcag-gcgcgcct	Protospacer
.****** **************** *** * . 

98. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
aagcccgtctgcaccgcgccgaacgtggccgc	Protospacer
. **   ********* ***************

99. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788

gatgcgcaaggcgcgcaagcgcaagggcaacag--	CRISPR spacer
gctgagcaaggcgcgcaagcgcgagg--agctggt	Protospacer
* ** *****************.***  *.* *  

100. spacer 1.32|37035|33|NC_009468|PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
caagcccgtctgcaccgcgccgaacgtggccgc	Protospacer
 . **   ********* ***************

101. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 7, identity: 0.781

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
aagttcaaggcgcgcaagcagaagggcaagat	Protospacer
* *. **************. ******** * 

102. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
aagttcaaggcgcgcaagcagaagggcaagat	Protospacer
* *. **************. ******** * 

103. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

atgcgcaaggcgcgcaagcgcaagggcaacag--	CRISPR spacer
ctgagcaaggcgcgcaagcgcgagg--agctggt	Protospacer
 ** *****************.***  *.* *  

104. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 7, identity: 0.781

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaacacgccctgttcgacatgctgcgcgagga	Protospacer
   *.******* ********* ******** 

105. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP005193 (Sphingobium sp. MI1205 plasmid pMI4, complete sequence) position: , mismatch: 7, identity: 0.781

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaacacgccctgttcgacatgctgcgcgagga	Protospacer
   *.******* ********* ******** 

106. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 7, identity: 0.781

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaacacgccctgttcgacatgctgcgcgagga	Protospacer
   *.******* ********* ******** 

107. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 7, identity: 0.781

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaacacgccctgttcgacatgctgcgcgagga	Protospacer
   *.******* ********* ******** 

108. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 7, identity: 0.781

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaacacgccctgttcgacatgctgcgcgagga	Protospacer
   *.******* ********* ******** 

109. spacer 1.64|36853|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 7, identity: 0.781

ccgttcgtctggatcgtagatcgcgaaatgac	CRISPR spacer
ccgttcgtctgggtcgtcgatcgcgtcgcgcc	Protospacer
************.**** *******  ..* *

110. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

gtgcggt-tctgcaccgggccgaacgtggccgc	CRISPR spacer
-tgccgcgtctgcagcgagccgaacgtggccca	Protospacer
 *** *. ****** **.*************  

111. spacer 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT matches to CP031731 (Stenotrophomonas rhizophila strain GA1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

aacgtgacaacgcccgtcgcctgcgcggtgag	CRISPR spacer
aacgagccaacgcccgtcgcctgcttcgcgat	Protospacer
**** * ***************** . *.** 

112. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NZ_CP007735 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-a41, complete sequence) position: , mismatch: 8, identity: 0.758

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
caagttcaaggcgcgcaagcagaagggcaagat	Protospacer
 * *. **************. ******** * 

113. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 8, identity: 0.758

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
gatccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
*** *************** ****  **..*. 

114. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 8, identity: 0.758

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
gatccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
*** *************** ****  **..*. 

115. spacer 1.5|35388|33|NC_009468|PILER-CR matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 8, identity: 0.758

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
gatccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
*** *************** ****  **..*. 

116. spacer 1.5|35388|33|NC_009468|PILER-CR matches to CP032292 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0073 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gatgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
caagttcaaggcgcgcaagcagaagggcaagat	Protospacer
 * *. **************. ******** * 

117. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_CP005192 (Sphingobium sp. MI1205 plasmid pMI3, complete sequence) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cgaacacgccctgttcgacatgctgcgcgagga	Protospacer
    *.******* ********* ******** 

118. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_CP005087 (Sphingobium sp. TKS plasmid pTK3, complete sequence) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cgaacacgccctgttcgacatgctgcgcgagga	Protospacer
    *.******* ********* ******** 

119. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NC_020562 (Sphingomonas sp. MM-1 plasmid pISP1, complete sequence) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cgaacacgccctgttcgacatgctgcgcgagga	Protospacer
    *.******* ********* ******** 

120. spacer 1.7|35510|33|NC_009468|PILER-CR matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
ggcgcgcgtcctgatcgacatgcaccgcgacca	Protospacer
* . ****.*************** *****   

121. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_CP005193 (Sphingobium sp. MI1205 plasmid pMI4, complete sequence) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cgaacacgccctgttcgacatgctgcgcgagga	Protospacer
    *.******* ********* ******** 

122. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NC_020563 (Sphingomonas sp. MM-1 plasmid pISP4, complete sequence) position: , mismatch: 8, identity: 0.758

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
cgaacacgccctgttcgacatgctgcgcgagga	Protospacer
    *.******* ********* ******** 

123. spacer 1.10|35693|33|NC_009468|PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.758

gcgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
gcgaatccggaattcgccgcgttccgcacgtgg	Protospacer
******  ****************...***.  

124. spacer 1.10|35693|33|NC_009468|PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.758

gcgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
gcgaatccggaattcgccgcgttccgcacgtgg	Protospacer
******  ****************...***.  

125. spacer 1.29|36852|33|NC_009468|PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.758

gccgttcgtctggatcgtagatcgcgaaatgac	CRISPR spacer
tccgttcgtctgggtcgtcgatcgcgtcgcgcc	Protospacer
 ************.**** *******  ..* *

126. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758

ggtgcggttctgcaccgggccgaacg--tggccgc	CRISPR spacer
ggtgcgggtcggcaccgggccgaagagctggtt--	Protospacer
******* ** ************* .  ***..  

127. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 8, identity: 0.758

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
ggtgcggttctggaccggcccgaagggctacgg	Protospacer
************ ***** ***** *    ** 

128. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP010598 (Phaeobacter inhibens strain P10 plasmid pP10_c, complete sequence) position: , mismatch: 8, identity: 0.75

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
atccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
** *************** ****  **..*. 

129. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NC_018288 (Phaeobacter inhibens DSM 17395 plasmid pPGA1_65, complete sequence) position: , mismatch: 8, identity: 0.75

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
atccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
** *************** ****  **..*. 

130. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 8, identity: 0.75

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
atccgcaaggcgcgcaagggcaaccgcggcgc	Protospacer
** *************** ****  **..*. 

131. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 8, identity: 0.75

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gcgcgcgtcctgatcgacatgcaccgcgacca	Protospacer
 . ****.*************** *****   

132. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 8, identity: 0.75

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gcgcgcgccctgatcggcaagcagcgcggtgc	Protospacer
 . *************.** ********. *.

133. spacer 1.44|35633|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75

ttttttgaacagccggaattgattgaacagtt	CRISPR spacer
ctccaggatcagccggaactgattgaacagct	Protospacer
.*..  ** *********.***********.*

134. spacer 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP007516 (Rubrobacter radiotolerans strain RSPS-4 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75

cgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
tatgcgtggaattcgccgcgctctataagctc	Protospacer
.. ..* *************.****** ****

135. spacer 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

cgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
cgaatccggaattcgccgcgttccgcacgtgg	Protospacer
*****  ****************...***.  

136. spacer 1.45|35694|32|NC_009468|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75

cgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
cgaatccggaattcgccgcgttccgcacgtgg	Protospacer
*****  ****************...***.  

137. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 8, identity: 0.75

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
cctgcccttccggagacggctccctccgccat	Protospacer
. *  *  ******* ****** *********

138. spacer 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
gacgacgttgcccgagggcgcacgctcgccgg	Protospacer
**.. ******* ** ************* . 

139. spacer 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 8, identity: 0.75

gatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
gacgacgttgcccgagggcgcacgctcgccgg	Protospacer
**.. ******* ** ************* . 

140. spacer 1.55|36304|32|NC_009468|CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 8, identity: 0.75

gatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
gacgacgttgcccgagggcgcacgctcgccgg	Protospacer
**.. ******* ** ************* . 

141. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
ttcgatttccgcaccgggccgaacctggccgt	Protospacer
 *  . ***.************** ******.

142. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
ttcgatttccgcaccgggccgaacctggccgt	Protospacer
 *  . ***.************** ******.

143. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
atgcggttctgcaccgggcccatcgcgatatc	Protospacer
.******************* * **.*..  *

144. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacg--tggccgc	CRISPR spacer
gtgcgggtcggcaccgggccgaagagctggtt--	Protospacer
****** ** ************* .  ***..  

145. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
gtgcggttctggaccggcccgaagggctacgg	Protospacer
*********** ***** ***** *    ** 

146. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to MT270409 (Phaeobacter phage MD18, complete genome) position: , mismatch: 8, identity: 0.75

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
tggcggtcctgcaccgggcagaacgccgcacc	Protospacer
  *****.*********** *****. **  *

147. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

148. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

149. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

150. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

151. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

152. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

153. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

154. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

155. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

156. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

157. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

158. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

159. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

160. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

161. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

162. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

163. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

164. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

165. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

166. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

167. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

168. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
cctatcatcgtatccgcgcgggcattcacgaa	Protospacer
.*.. ****** ******* **********  

169. spacer 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.75

cctgacaccggcgacacggccctcagccgctc	CRISPR spacer
cgttccgccggcgacaccgccatcagccgcat	Protospacer
* *  *.********** *** ******** .

170. spacer 1.73|37402|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 8, identity: 0.75

aacgtgacaacgcccgtcgcctgcgcggtgag	CRISPR spacer
aacgtgacaacgcccgtcgaccgccacttaac	Protospacer
******************* *.**    *.* 

171. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.727

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
tgcgcgcgccctgatcggcaagcagcgcggtgc	Protospacer
  . *************.** ********. *.

172. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.727

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
ggccagcgacctgatcgacatgcagtgcgatac	Protospacer
* .. *** ****************.**** ..

173. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.727

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
ggccagcgacctgatcgacatgcagtgcgatac	Protospacer
* .. *** ****************.**** ..

174. spacer 1.9|35632|33|NC_009468|PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 9, identity: 0.727

gttttttgaacagccggaattgattgaacagtt	CRISPR spacer
cctccaggatcagccggaactgattgaacagct	Protospacer
 .*..  ** *********.***********.*

175. spacer 1.10|35693|33|NC_009468|PILER-CR matches to NZ_CP007516 (Rubrobacter radiotolerans strain RSPS-4 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.727

gcgaatgaggaattcgccgcgttctatacgctc	CRISPR spacer
atatgcgtggaattcgccgcgctctataagctc	Protospacer
... ..* *************.****** ****

176. spacer 1.11|35754|33|NC_009468|PILER-CR matches to KM389229 (UNVERIFIED: Pseudomonas phage F_TK1718sp/PAK clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.727

gtgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
acctgcccttccggagacggctccctccgccat	Protospacer
.. *  *  ******* ****** *********

177. spacer 1.20|36303|33|NC_009468|PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 9, identity: 0.727

ggatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
tgacgacgttgcccgagggcgcacgctcgccgg	Protospacer
 **.. ******* ** ************* . 

178. spacer 1.20|36303|33|NC_009468|PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.727

ggatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
tgacgacgttgcccgagggcgcacgctcgccgg	Protospacer
 **.. ******* ** ************* . 

179. spacer 1.20|36303|33|NC_009468|PILER-CR matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 9, identity: 0.727

ggatatcgttgccagacggcgcacgctcgcaat	CRISPR spacer
tgacgacgttgcccgagggcgcacgctcgccgg	Protospacer
 **.. ******* ** ************* . 

180. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.727

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
tttcgatttccgcaccgggccgaacctggccgt	Protospacer
  *  . ***.************** ******.

181. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.727

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
tttcgatttccgcaccgggccgaacctggccgt	Protospacer
  *  . ***.************** ******.

182. spacer 1.32|37035|33|NC_009468|PILER-CR matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

ggtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
catgcggttctgcaccgggcccatcgcgatatc	Protospacer
 .******************* * **.*..  *

183. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
gcctgcaaggcgctcaagcgcaacggcttcac	Protospacer
.. .********* ********* ***  ** 

184. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to MN586020 (Microbacterium phage Megan, complete genome) position: , mismatch: 9, identity: 0.719

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
cgccgcaacgcgcccaagcgcaaggggccgag	Protospacer
   ***** **** ************    **

185. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_GU811235 (Sphingobium chungbukense strain DJ77 plasmid pSY3, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaggatgccctgttcgacatgctgcgcgagga	Protospacer
    ..****** ********* ******** 

186. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gccagcgacctgatcgacatgcagtgcgatac	Protospacer
 .. *** ****************.**** ..

187. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gccagcgacctgatcgacatgcagtgcgatac	Protospacer
 .. *** ****************.**** ..

188. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
catctcgccctgctcgacatgcagctgcccct	Protospacer
* ** ******* ************      *

189. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gccccagacctgatcgacatagagcgcgaggc	Protospacer
 ..*  * ************. *********.

190. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gatctgcttctcatcgacatccagcgcgaggt	Protospacer
  **   ..** ******** ***********

191. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
tcgggcatcctgttcgacatgcaccgcgaggc	Protospacer
..  **..**** ********** *******.

192. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 9, identity: 0.719

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
accgccgccctgctcgacctgcagcgcgggtt	Protospacer
 ..  ******* ***** *********.* *

193. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
cgcacgacgccggagtcggctccctccgtcat	Protospacer
.*.   *  ************* *****.***

194. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 9, identity: 0.719

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
cgcacgacgccggagtcggctccctccgtcat	Protospacer
.*.   *  ************* *****.***

195. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
cgcacgacgccggagtcggctccctccgtcat	Protospacer
.*.   *  ************* *****.***

196. spacer 1.46|35755|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

tgtcgcaatccggagtcggctcgctccgccat	CRISPR spacer
cgcacgacgccggagtcggctccctccgtcat	Protospacer
.*.   *  ************* *****.***

197. spacer 1.54|36243|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gcagaggcagcagagaggcgatgcaccgaatt	CRISPR spacer
gcagacgcagcggagaggcgatgacgcgtccg	Protospacer
***** *****.***********   **  . 

198. spacer 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP013486 (Vibrio alginolyticus strain ATCC 33787 plasmid pMBL128, complete sequence) position: , mismatch: 9, identity: 0.719

cgacgccggacgctcgcgaaatcgcctttgtg	CRISPR spacer
agctggtggacgctggcgcaatcgcctttgat	Protospacer
 * .* .******* *** ***********  

199. spacer 1.67|37036|32|NC_009468|CRISPRCasFinder,CRT matches to MG641885 (Salmonella phage PMBT28, complete genome) position: , mismatch: 9, identity: 0.719

gtgcggttctgcaccgggccgaacgtggccgc	CRISPR spacer
tagaagttctgcaccggggcgaacgtggtgtt	Protospacer
  * .************* *********.  .

200. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP051517 (Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1) position: , mismatch: 9, identity: 0.719

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
tttgcgtagcgatcgcggcggcaacgaagaag	Protospacer
*. ***** ** ************** .*. .

201. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
tgacgccgtcgctcggggcggcaaggtgggtg	Protospacer
* *   ..******* ******** ******.

202. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP041223 (Porphyrobacter sp. YT40 plasmid pYT40, complete sequence) position: , mismatch: 9, identity: 0.719

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
tctgcgtatcgcccgcggcggcactttccatg	Protospacer
** *********.********** . *  .*.

203. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to MK310144 (Mycobacterium phage CicholasNage, complete genome) position: , mismatch: 9, identity: 0.719

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
tattcaggccgctcgcggcggcaaggtggata	Protospacer
*   *. ..*************** ****.**

204. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to KX388536 (Agrobacterium tumefaciens strain Chry5 plasmid pTiChry5, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

205. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_KY000032 (Agrobacterium fabrum strain CFBP2788 plasmid pTi_CFBP2788, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

206. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_KY000032 (Agrobacterium fabrum strain CFBP2788 plasmid pTi_CFBP2788, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

207. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

208. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

209. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

210. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_KY000074 (Agrobacterium larrymoorei strain CFBP5481 plasmid pTi_CFBP5481, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

211. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccaccgatcgtatccgggccggcattcacgat	Protospacer
.*    ***** **** ************* .

212. spacer 1.71|37280|32|NC_009468|CRISPRCasFinder,CRT matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 9, identity: 0.719

tccggcatcgtttccgcgccggcattcacgcc	CRISPR spacer
ccacccgtcgtgtccgcgccggcgttcacgat	Protospacer
.*   *.**** ***********.****** .

213. spacer 1.7|35510|33|NC_009468|PILER-CR matches to NZ_GU811235 (Sphingobium chungbukense strain DJ77 plasmid pSY3, complete sequence) position: , mismatch: 10, identity: 0.697

gcttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
tgaggatgccctgttcgacatgctgcgcgagga	Protospacer
     ..****** ********* ******** 

214. spacer 1.36|35145|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP022416 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgcctgggaggatatggagcgctggattgat	CRISPR spacer
tgacgatggaggatatggaacgctggcttgcg	Protospacer
. .*   ************.****** ***  

215. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 10, identity: 0.688

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
cagcgcaaggcgcgcacgcgccaggctcggcg	Protospacer
  ************** **** *** . .  *

216. spacer 1.40|35389|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 10, identity: 0.688

atgcgcaaggcgcgcaagcgcaagggcaacag	CRISPR spacer
ggcggcaaggtgcccaagcgcaagggcgccta	Protospacer
.   ******.** *************. * .

217. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP018668 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_5, complete sequence) position: , mismatch: 10, identity: 0.688

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gaggaagccctgttcgacatgctgcgcgatga	Protospacer
    . ****** ********* ****** * 

218. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 10, identity: 0.688

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gccgtcttcctcatcgacatgaagcgcgaggc	Protospacer
 ..  * .*** ********* *********.

219. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.688

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
gccgtcttcctcatcgacatgaagcgcgaggc	Protospacer
 ..  * .*** ********* *********.

220. spacer 1.42|35511|32|NC_009468|CRISPRCasFinder,CRT matches to MN478374 (Bacteriophage Phobos, complete genome) position: , mismatch: 10, identity: 0.688

cttcgcgccctgatcgacatgcagcgcgaggt	CRISPR spacer
agcaaagccctgaacgacatgctgcgcgacga	Protospacer
  . . ******* ******** ****** * 

221. spacer 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 10, identity: 0.688

gggtatacgtgctaccggcgggggctggagta	CRISPR spacer
accgagctgtgcgaccggctggggctggagtg	Protospacer
.   *  .**** ****** ***********.

222. spacer 1.47|35816|32|NC_009468|CRISPRCasFinder,CRT matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 10, identity: 0.688

gggtatacgtgctaccggcgggggctggagta	CRISPR spacer
accgagctgtgcgaccggctggggctggagtg	Protospacer
.   *  .**** ****** ***********.

223. spacer 1.48|35877|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 10, identity: 0.688

tggccgatgctcgcgcagaaagtgggcgtgtg	CRISPR spacer
gcatccatgctcgcgcagtaagtgagcgtacc	Protospacer
  ..* ************ *****.****.. 

224. spacer 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP015041 (Rhodovulum sp. P5 plasmid pRGUI02, complete sequence) position: , mismatch: 10, identity: 0.688

taaagcgcggcgtccccccgcgccgcaaaagc	CRISPR spacer
tggcacgcgccgtcaccccgcgccgcaaggcg	Protospacer
*.. .**** **** *************..  

225. spacer 1.50|35999|32|NC_009468|CRISPRCasFinder,CRT matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 10, identity: 0.688

taaagcgcggcgtccccccgcgccgcaaaagc	CRISPR spacer
accagcgcggcgtctccgcgcgccgcgcgctc	Protospacer
   ***********.** ********. .  *

226. spacer 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688

cgacgccggacgctcgcgaaatcgcctttgtg	CRISPR spacer
ctgcgccggacggtctcgaaatcgcccagcac	Protospacer
* .********* ** **********.     

227. spacer 1.60|36609|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_AP014801 (Rhodovulum sulfidophilum plasmid Plasmid1 DNA, complete genome, strain: DSM 2351) position: , mismatch: 10, identity: 0.688

cgacgccggacgctcgcgaaatcgcctttgtg	CRISPR spacer
ctgcgccggacggtctcgaaatcgcccagcac	Protospacer
* .********* ** **********.     

228. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
agggcgtctcgctcgcggcggcaacggtttcg	Protospacer
  .**** ******************    ..

229. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 10, identity: 0.688

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
ccgcaatagcgctggcggcggcaacgtggtcc	Protospacer
.*.  .** **** *************** . 

230. spacer 1.68|37097|32|NC_009468|CRISPRCasFinder,CRT matches to MH593834 (Siphoviridae sp. isolate ctbe1, complete genome) position: , mismatch: 10, identity: 0.688

tcagcgtatcgctcgcggcggcaacgtgggta	CRISPR spacer
ggtgagtatcgctcgccgtggcaacgtgctgc	Protospacer
   * *********** *.*********    

231. spacer 1.69|37158|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_LN614828 (Legionella fallonii LLAP-10 plasmid II, complete sequence) position: , mismatch: 10, identity: 0.688

tttacgttgtattgggtgcggcgagacgggca	CRISPR spacer
tttatgttgtattgtgtgcggcgttgagcctc	Protospacer
****.********* ********  . *  . 

232. spacer 1.72|37341|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688

cctgacaccggcgacacggccctcagccgctc	CRISPR spacer
aggcacaccgccgacacggccatcagcgcgac	Protospacer
    ****** ********** *****    *

233. spacer 1.65|36914|32|NC_009468|CRISPRCasFinder,CRT matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 11, identity: 0.656

gattgtcaggtaatcgccgagcgtctgataaa	CRISPR spacer
atcggtcagataatcggcgagcgtctgcaggg	Protospacer
. . *****.****** **********  ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 5853 : 56460 51 Aeromonas_phage(16.67%) transposase NA
DBSCAN-SWA_2 94822 : 132533 30 Acidithiobacillus_phage(25.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. NC_009469
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12625 : 45584 28 Acidithiobacillus_phage(14.29%) transposase,integrase attL 14909:14926|attR 45219:45236
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. NC_009484
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009484_1 232843-232968 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009484_2 1300540-1302395 Orphan NA
32 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009484_1 1.1|232861|18|NC_009484|CRT 232861-232878 18 NC_009484.1 216010-216027 2 0.889
NC_009484_1 1.2|232897|18|NC_009484|CRT 232897-232914 18 NC_009484.1 1629868-1629885 2 0.889
NC_009484_1 1.3|232933|18|NC_009484|CRT 232933-232950 18 NC_009484.1 748713-748730 2 0.889
NC_009484_1 1.3|232933|18|NC_009484|CRT 232933-232950 18 NC_009484.1 777160-777177 2 0.889

1. spacer 1.1|232861|18|NC_009484|CRT matches to position: 216010-216027, mismatch: 2, identity: 0.889

gggggcgcgctggatgcc	CRISPR spacer
gggcgcgcgctcgatgcc	Protospacer
*** ******* ******

2. spacer 1.2|232897|18|NC_009484|CRT matches to position: 1629868-1629885, mismatch: 2, identity: 0.889

ggtctcctcgccgatccc	CRISPR spacer
gggctcatcgccgatccc	Protospacer
** *** ***********

3. spacer 1.3|232933|18|NC_009484|CRT matches to position: 748713-748730, mismatch: 2, identity: 0.889

ggcttcctgttcaatgcc	CRISPR spacer
ggcggcctgttcaatgcc	Protospacer
***  *************

4. spacer 1.3|232933|18|NC_009484|CRT matches to position: 777160-777177, mismatch: 2, identity: 0.889

ggcttcctgttcaatgcc	CRISPR spacer
ggcctgctgttcaatgcc	Protospacer
***.* ************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 1 0.96
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2376925-2376949 2 0.92
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1250386-1250410 2 0.92
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 63390-63414 2 0.92
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_004771 Pasteurella multocida plasmid pJR1, complete sequence 2845-2869 2 0.92
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 248-272 2 0.92
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 MK686068 Streptomyces phage RemusLoopin, complete genome 15053-15077 2 0.92
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 58757-58781 2 0.92
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 55632-55656 2 0.92
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 58751-58775 2 0.92
NC_009484_2 2.3|1300677|25|NC_009484|CRT 1300677-1300701 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 3 0.88
NC_009484_2 2.3|1300677|25|NC_009484|CRT 1300677-1300701 25 MK967384 Gordonia phage Sidious, complete genome 11404-11428 3 0.88
NC_009484_2 2.4|1300722|25|NC_009484|CRT 1300722-1300746 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 3 0.88
NC_009484_2 2.4|1300722|25|NC_009484|CRT 1300722-1300746 25 MK967384 Gordonia phage Sidious, complete genome 11404-11428 3 0.88
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 NZ_CP006368 Aureimonas sp. AU20 plasmid pAU20a, complete sequence 84652-84676 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP017784 Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence 12196-12220 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MT081181 Uncultured bacterium plasmid pCu_H_1, complete sequence 5770-5794 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP049911 Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence 136625-136649 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 91771-91795 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 147926-147950 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 136967-136991 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 136971-136995 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 44051-44075 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 249490-249514 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 216734-216758 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 431-455 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 1590-1614 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 381005-381029 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 17804-17828 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP010723 Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence 5246-5270 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 169765-169789 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 45560-45584 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 27032-27056 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP028920 Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence 123514-123538 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 65071-65095 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP038103 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence 120511-120535 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 65071-65095 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 36080-36104 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 88848-88872 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 53060-53084 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 27032-27056 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 103735-103759 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 6526-6550 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP017783 Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence 21951-21975 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_KX364409 Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence 19505-19529 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 194512-194536 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 275694-275718 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 37914-37938 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 37804-37828 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 174878-174902 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 45213-45237 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 38816-38840 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 165352-165376 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 99804-99828 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 145073-145097 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 58771-58795 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434323-434347 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MT011984 Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence 39115-39139 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 44808-44832 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 237517-237541 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 1127434-1127458 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 729164-729188 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 322433-322457 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 386420-386444 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MN270887 Pectobacterium phage CX5, complete genome 3724-3748 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MN270888 Pectobacterium phage CX5-1, complete genome 3724-3748 3 0.88
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP034331 Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence 1414-1438 3 0.88
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251695-251719 3 0.88
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 82777-82801 3 0.88
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2376649-2376673 3 0.88
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1250662-1250686 3 0.88
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251785-251809 3 0.88
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 248-272 3 0.88
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 MK686068 Streptomyces phage RemusLoopin, complete genome 15053-15077 3 0.88
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 1360-1384 3 0.88
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251785-251809 3 0.88
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 248-272 3 0.88
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 MK686068 Streptomyces phage RemusLoopin, complete genome 15053-15077 3 0.88
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 1360-1384 3 0.88
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 58766-58790 3 0.88
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NC_016037 Komagataeibacter medellinensis NBRC 3288 plasmid pGXY010, complete sequence 56978-57002 3 0.88
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 51300-51324 3 0.88
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NC_008757 Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence 316921-316945 3 0.88
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 AJ006589 Bacteriophage phi-C31 complete genome 15948-15972 3 0.88
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 KP790011 Gordonia phage Gsput1, complete genome 11856-11880 3 0.88
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 Z99661 Bacteriophage phi-C31 late region gene 49 807-831 3 0.88
NC_009484_2 2.3|1300677|25|NC_009484|CRT 1300677-1300701 25 MN428048 Gordonia phage DobbysSock, complete genome 3145-3169 4 0.84
NC_009484_2 2.4|1300722|25|NC_009484|CRT 1300722-1300746 25 MN428048 Gordonia phage DobbysSock, complete genome 3145-3169 4 0.84
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 4 0.84
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 MK801727 Gordonia phage ThankyouJordi, complete genome 11951-11975 4 0.84
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 MT723938 Gordonia phage Bunnybear, complete genome 11941-11965 4 0.84
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 MK875793 Gordonia phage WelcomeAyanna, complete genome 11951-11975 4 0.84
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 271812-271836 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 89-113 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531076-531100 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531184-531208 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531292-531316 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531400-531424 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 531508-531532 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 87-111 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 231-255 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 375-399 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 519-543 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 744-768 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 843-867 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 942-966 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 1041-1065 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 1140-1164 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 1248-1272 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 647921-647945 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 648038-648062 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434125-434149 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434359-434383 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1156377-1156401 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 784016-784040 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 131-155 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 553093-553117 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 553201-553225 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 553318-553342 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 350827-350851 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 668893-668917 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 755816-755840 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 784057-784081 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 755816-755840 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 755816-755840 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 755820-755844 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 755816-755840 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1962027-1962051 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP042825 Rhizobium sp. WL3 plasmid unnamed2, complete sequence 408002-408026 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 293233-293257 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NC_019957 Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence 283575-283599 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_LR026982 Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence 28329-28353 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1290652-1290676 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1290652-1290676 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 137465-137489 4 0.84
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 MN694114 Marine virus AFVG_250M252, complete genome 19706-19730 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434098-434122 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434224-434248 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434305-434329 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP042264 Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence 17284-17308 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251686-251710 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 463447-463471 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 301432-301456 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 515400-515424 4 0.84
NC_009484_2 2.11|1301091|25|NC_009484|CRT 1301091-1301115 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 919134-919158 4 0.84
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 NZ_AP014803 Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351 18484-18508 4 0.84
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 MK450426 Streptomyces phage Euratis, complete genome 15131-15155 4 0.84
NC_009484_2 2.17|1301415|25|NC_009484|CRT 1301415-1301439 25 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2056775-2056799 4 0.84
NC_009484_2 2.17|1301415|25|NC_009484|CRT 1301415-1301439 25 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1570536-1570560 4 0.84
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 NZ_AP014803 Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351 18484-18508 4 0.84
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 MK450426 Streptomyces phage Euratis, complete genome 15131-15155 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 541935-541959 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP006370 Aureimonas sp. AU20 plasmid pAU20c, complete sequence 214391-214415 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 109365-109389 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 36390-36414 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 172784-172808 4 0.84
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 KP790011 Gordonia phage Gsput1, complete genome 11856-11880 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251785-251809 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 82777-82801 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 248-272 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1045162-1045186 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 1360-1384 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434098-434122 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2281679-2281703 4 0.84
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 MK686068 Streptomyces phage RemusLoopin, complete genome 15053-15077 4 0.84
NC_009484_2 2.3|1300677|25|NC_009484|CRT 1300677-1300701 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434098-434122 5 0.8
NC_009484_2 2.4|1300722|25|NC_009484|CRT 1300722-1300746 25 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 434098-434122 5 0.8
NC_009484_2 2.6|1300821|25|NC_009484|CRT 1300821-1300845 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5034357-5034381 5 0.8
NC_009484_2 2.9|1300992|25|NC_009484|CRT 1300992-1301016 25 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 399798-399822 5 0.8
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 2376640-2376673 5 0.853
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 1250662-1250695 5 0.853
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 251686-251719 5 0.853
NC_009484_2 2.14|1301244|25|NC_009484|CRT 1301244-1301268 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 5 0.8
NC_009484_2 2.21|1301658|25|NC_009484|CRT 1301658-1301682 25 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65411 5 0.8
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_KM017071 Sphingomonas sp. JE1 plasmid pJE1, complete sequence 144750-144774 5 0.8
NC_009484_2 2.22|1301703|25|NC_009484|CRT 1301703-1301727 25 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 106284-106308 5 0.8
NC_009484_2 2.29|1302162|25|NC_009484|CRT 1302162-1302186 25 NZ_LR134469 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence 128202-128226 5 0.8
NC_009484_2 2.3|1300677|25|NC_009484|CRT 1300677-1300701 25 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 660166-660190 6 0.76
NC_009484_2 2.4|1300722|25|NC_009484|CRT 1300722-1300746 25 NZ_CP045385 Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence 660166-660190 6 0.76
NC_009484_2 2.1|1300560|34|NC_009484|CRT 1300560-1300593 34 NC_015952 Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence 73239-73272 7 0.794
NC_009484_2 2.28|1302108|34|NC_009484|CRT 1302108-1302141 34 MN116494 Klebsiella phage vB_KpnP_Bp5, complete genome 13884-13917 7 0.794
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 NZ_LR134450 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence 174051-174084 8 0.765
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_004771 Pasteurella multocida plasmid pJR1, complete sequence 2836-2869 8 0.765
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 63390-63423 8 0.765
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 1262263-1262296 8 0.765
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_004771 Pasteurella multocida plasmid pJR1, complete sequence 2836-2869 8 0.765
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_AP022611 Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574 63390-63423 8 0.765
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1045153-1045186 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP017783 Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence 21951-21984 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP017784 Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence 12187-12220 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_KX364409 Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence 19505-19538 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MT081181 Uncultured bacterium plasmid pCu_H_1, complete sequence 5761-5794 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP049911 Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence 136616-136649 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 91762-91795 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 147917-147950 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 194512-194545 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 136958-136991 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 136962-136995 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 44042-44075 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 275694-275727 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 216734-216767 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 249481-249514 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 380996-381029 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 37914-37947 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 17795-17828 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 37804-37837 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 174878-174911 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 45213-45246 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP010723 Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence 5237-5270 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 169756-169789 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 45551-45584 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 27023-27056 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 38816-38849 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP028920 Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence 123505-123538 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 165352-165385 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 99804-99837 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 65062-65095 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 145073-145106 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP038103 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence 120502-120535 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 58771-58804 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 65062-65095 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 36071-36104 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 88839-88872 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 53051-53084 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MT011984 Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence 39115-39148 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 27023-27056 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 44808-44841 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 103726-103759 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 237517-237550 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 6517-6550 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MT897910 Mycobacterium phage VioletZ, complete genome 29904-29937 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MN369759 Mycobacterium phage Mithril, complete genome 29846-29879 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MT818419 Mycobacterium phage Lolalove, complete genome 29842-29875 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MN428050 Mycobacterium phage Apex, complete genome 30011-30044 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MK524486 Mycobacterium phage Waleliano, complete genome 29831-29864 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MN234171 Mycobacterium phage Magpie, complete genome 29671-29704 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MH513970 Mycobacterium phage Hangman, complete genome 29828-29861 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 KX589269 Mycobacterium phage Fortunato, complete genome 29827-29860 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 MT639648 Mycobacterium phage Heath, complete genome 29429-29462 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 29831-29864 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 28796-28829 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_022331 Mycobacterium phage Bane1, complete genome 29504-29537 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 KF279413 Mycobacterium phage Bane2, complete genome 29483-29516 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 KF493881 Mycobacterium phage JAMaL, complete genome 30015-30048 9 0.735
NC_009484_2 2.7|1300866|34|NC_009484|CRT 1300866-1300899 34 NC_028968 Mycobacterium phage BrownCNA, complete genome 30097-30130 9 0.735
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 65387-65420 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP017783 Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence 21951-21984 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP017784 Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence 12187-12220 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_KX364409 Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence 19505-19538 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MT081181 Uncultured bacterium plasmid pCu_H_1, complete sequence 5761-5794 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP049911 Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence 136616-136649 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP025470 Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence 91762-91795 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_022078 Klebsiella pneumoniae JM45 plasmid p1, complete sequence 147917-147950 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP039989 Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence 194512-194545 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP027038 Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence 136958-136991 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP027055 Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2 136962-136995 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 CP052444 Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence 44042-44075 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP030080 Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence 275694-275727 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 216734-216767 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP039991 Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence 249481-249514 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 380996-381029 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP031802 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence 37914-37947 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP028996 Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence 17795-17828 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP040034 Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence 37804-37837 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP027043 Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence 174878-174911 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP011571 Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence 45213-45246 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP010723 Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence 5237-5270 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP017084 Proteus mirabilis strain T21 plasmid pT212, complete sequence 169756-169789 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP040029 Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence 45551-45584 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP031122 Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence 27023-27056 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MG879028 Uncultured bacterium plasmid pEG1-1, complete sequence 38816-38849 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP028920 Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence 123505-123538 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MN823999 Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence 165352-165385 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MN842293 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence 99804-99837 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP011580 Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence 65062-65095 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP013115 Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence 145073-145106 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP038103 Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence 120502-120535 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP011583 Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence 58771-58804 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP011649 Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence 65062-65095 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_016839 Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence 36071-36104 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 88839-88872 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_MH917284 Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence 53051-53084 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MT011984 Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence 39115-39148 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_MF344574 Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence 27023-27056 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_CP030132 Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence 44808-44841 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_MF150084 Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence 103726-103759 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_KY883660 Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence 237517-237550 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NZ_MF150118 Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence 6517-6550 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MT897910 Mycobacterium phage VioletZ, complete genome 29904-29937 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MN369759 Mycobacterium phage Mithril, complete genome 29846-29879 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MT818419 Mycobacterium phage Lolalove, complete genome 29842-29875 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MN428050 Mycobacterium phage Apex, complete genome 30011-30044 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MK524486 Mycobacterium phage Waleliano, complete genome 29831-29864 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MN234171 Mycobacterium phage Magpie, complete genome 29671-29704 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MH513970 Mycobacterium phage Hangman, complete genome 29828-29861 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 KX589269 Mycobacterium phage Fortunato, complete genome 29827-29860 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 MT639648 Mycobacterium phage Heath, complete genome 29429-29462 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_042035 Mycobacterium phage Zemanar, complete sequence 29831-29864 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 28796-28829 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_022331 Mycobacterium phage Bane1, complete genome 29504-29537 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 KF279413 Mycobacterium phage Bane2, complete genome 29483-29516 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 KF493881 Mycobacterium phage JAMaL, complete genome 30015-30048 9 0.735
NC_009484_2 2.15|1301289|34|NC_009484|CRT 1301289-1301322 34 NC_028968 Mycobacterium phage BrownCNA, complete genome 30097-30130 9 0.735
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 NZ_AP019743 Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA3, complete sequence 3664-3697 11 0.676
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 NZ_CP022285 Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence 163310-163343 11 0.676
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 MK531536 Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence 28066-28099 11 0.676
NC_009484_2 2.5|1300767|34|NC_009484|CRT 1300767-1300800 34 NZ_CP014652 Acinetobacter sp. DUT-2 plasmid unnamed1, complete sequence 78449-78482 11 0.676
NC_009484_2 2.12|1301136|34|NC_009484|CRT 1301136-1301169 34 NZ_CP010857 Marinovum algicola DG 898 plasmid pMaD2, complete sequence 51300-51333 11 0.676
NC_009484_2 2.13|1301190|34|NC_009484|CRT 1301190-1301223 34 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 366216-366249 11 0.676
NC_009484_2 2.28|1302108|34|NC_009484|CRT 1302108-1302141 34 NZ_CP039918 Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence 263156-263189 11 0.676
NC_009484_2 2.28|1302108|34|NC_009484|CRT 1302108-1302141 34 NZ_CP048633 Rhizobium oryzihabitans strain M15 plasmid p1, complete sequence 4392-4425 11 0.676
NC_009484_2 2.28|1302108|34|NC_009484|CRT 1302108-1302141 34 NZ_CP048637 Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence 82716-82749 11 0.676
NC_009484_2 2.28|1302108|34|NC_009484|CRT 1302108-1302141 34 NZ_KY000062 Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence 110337-110370 11 0.676

1. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.96

acccatcgcgcccgtggcgcccatc	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
***********************.*

2. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 2, identity: 0.92

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgcccgtggcgccggtc	Protospacer
 *********************** 

3. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 2, identity: 0.92

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgcccgtggcgccggtc	Protospacer
 *********************** 

4. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 2, identity: 0.92

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttacgcccgtggcgccggtg	Protospacer
 ******.*****************

5. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_004771 (Pasteurella multocida plasmid pJR1, complete sequence) position: , mismatch: 2, identity: 0.92

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggag	Protospacer
****************.****** *

6. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 2, identity: 0.92

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
accggtcgcgcccgtggcacctgtc	Protospacer
*** *****************.***

7. spacer 2.11|1301091|25|NC_009484|CRT matches to MK686068 (Streptomyces phage RemusLoopin, complete genome) position: , mismatch: 2, identity: 0.92

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
acccgtcgcgcccgtggctccggtc	Protospacer
****************** ** ***

8. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.92

acccatcgcgcccgtggcgcccatc	CRISPR spacer
acccatcgcgcccatcgcgcccatc	Protospacer
*************.* *********

9. spacer 2.22|1301703|25|NC_009484|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 2, identity: 0.92

acccatcgcgcccgtggcgcccatc	CRISPR spacer
acccatcgcgcccatcgcgcccatc	Protospacer
*************.* *********

10. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.92

acccatcgcgcccgtggcgcccatc	CRISPR spacer
acccatcgcgcccatcgcgcccatc	Protospacer
*************.* *********

11. spacer 2.3|1300677|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
******************.***..*

12. spacer 2.3|1300677|25|NC_009484|CRT matches to MK967384 (Gordonia phage Sidious, complete genome) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcacccgtc	CRISPR spacer
ccccatcgcggtcgtggcacccgtc	Protospacer
 ********* .*************

13. spacer 2.4|1300722|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
******************.***..*

14. spacer 2.4|1300722|25|NC_009484|CRT matches to MK967384 (Gordonia phage Sidious, complete genome) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcacccgtc	CRISPR spacer
ccccatcgcggtcgtggcacccgtc	Protospacer
 ********* .*************

15. spacer 2.6|1300821|25|NC_009484|CRT matches to NZ_CP006368 (Aureimonas sp. AU20 plasmid pAU20a, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgccggtggcgcccgtg	CRISPR spacer
ccccatcgcgacggtggcgcccctg	Protospacer
 ********* *********** **

16. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP017784 (Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

17. spacer 2.9|1300992|25|NC_009484|CRT matches to MT081181 (Uncultured bacterium plasmid pCu_H_1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

18. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

19. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

20. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

21. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

22. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

23. spacer 2.9|1300992|25|NC_009484|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

24. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

25. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

26. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
cccggttgcgcccgtagcgccggtc	Protospacer
.**************.******** 

27. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
cccggttgcgcccgtagcgccggtc	Protospacer
.**************.******** 

28. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

29. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

30. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP010723 (Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

31. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

32. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

33. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

34. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

35. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

36. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

37. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

38. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

39. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

40. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

41. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

42. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

43. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

44. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP017783 (Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

45. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

46. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

47. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

48. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

49. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

50. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

51. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

52. spacer 2.9|1300992|25|NC_009484|CRT matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

53. spacer 2.9|1300992|25|NC_009484|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

54. spacer 2.9|1300992|25|NC_009484|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

55. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

56. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

57. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcccccgtggcgccggtc	Protospacer
 ******** ************** 

58. spacer 2.9|1300992|25|NC_009484|CRT matches to MT011984 (Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

59. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

60. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgcccgtgacgccggac	Protospacer
****************.******  

61. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccggttgcgccggtt	Protospacer
************ ** ******** 

62. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccggttgcgccggtt	Protospacer
************ ** ******** 

63. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccggttgcgccggtt	Protospacer
************ ** ******** 

64. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccggttgcgccggtt	Protospacer
************ ** ******** 

65. spacer 2.9|1300992|25|NC_009484|CRT matches to MN270887 (Pectobacterium phage CX5, complete genome) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccagtggctccggta	Protospacer
************ ***** *****.

66. spacer 2.9|1300992|25|NC_009484|CRT matches to MN270888 (Pectobacterium phage CX5-1, complete genome) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgcgccagtggctccggta	Protospacer
************ ***** *****.

67. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP034331 (Tabrizicola piscis strain K13M18 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

tccggttgcgcccgtggcgccggtg	CRISPR spacer
tccggttgctcccgtgacgccggag	Protospacer
********* ******.****** *

68. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
acccgtcgcacccgttgcacccgtt	Protospacer
*********.***** ********.

69. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtcgcgcccgtggcaccggac	Protospacer
.******************** * *

70. spacer 2.11|1301091|25|NC_009484|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
acccgtcgcgcccgtggtaccggtg	Protospacer
*****************.*** ** 

71. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
acccgtcgcgcccgtggtaccggtg	Protospacer
*****************.*** ** 

72. spacer 2.14|1301244|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgttgcgcctgtc	Protospacer
*** *********** ******** 

73. spacer 2.14|1301244|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgtggcacctgtc	Protospacer
*** **************.***** 

74. spacer 2.14|1301244|25|NC_009484|CRT matches to MK686068 (Streptomyces phage RemusLoopin, complete genome) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgtggctccggtc	Protospacer
****************** ** ** 

75. spacer 2.14|1301244|25|NC_009484|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
atccgtcgcgcccctggcgcctgcg	Protospacer
*.*********** *********.*

76. spacer 2.21|1301658|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgttgcgcctgtc	Protospacer
*** *********** ******** 

77. spacer 2.21|1301658|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgtggcacctgtc	Protospacer
*** **************.***** 

78. spacer 2.21|1301658|25|NC_009484|CRT matches to MK686068 (Streptomyces phage RemusLoopin, complete genome) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgtggctccggtc	Protospacer
****************** ** ** 

79. spacer 2.21|1301658|25|NC_009484|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 3, identity: 0.88

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
atccgtcgcgcccctggcgcctgcg	Protospacer
*.*********** *********.*

80. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcgcccatc	CRISPR spacer
gcccatcgcgcccatcgcgcccatc	Protospacer
.************.* *********

81. spacer 2.22|1301703|25|NC_009484|CRT matches to NC_016037 (Komagataeibacter medellinensis NBRC 3288 plasmid pGXY010, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcgcccatc	CRISPR spacer
accaaccgcgcccgtggcgcccatg	Protospacer
*** *.****************** 

82. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 3, identity: 0.88

acccatcgcgcccgtggcgcccatc	CRISPR spacer
acccatcgcgcccgtggcggcgacc	Protospacer
******************* * *.*

83. spacer 2.29|1302162|25|NC_009484|CRT matches to NC_008757 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP01, complete sequence) position: , mismatch: 3, identity: 0.88

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcctgtcgcgcccgtggcgcccgcg	Protospacer
***.*****************.*.*

84. spacer 2.29|1302162|25|NC_009484|CRT matches to AJ006589 (Bacteriophage phi-C31 complete genome) position: , mismatch: 3, identity: 0.88

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgtgtcgcccttg	Protospacer
**************** ****. **

85. spacer 2.29|1302162|25|NC_009484|CRT matches to KP790011 (Gordonia phage Gsput1, complete genome) position: , mismatch: 3, identity: 0.88

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgtagcgcccatg	Protospacer
***************.*****..**

86. spacer 2.29|1302162|25|NC_009484|CRT matches to Z99661 (Bacteriophage phi-C31 late region gene 49) position: , mismatch: 3, identity: 0.88

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgtgtcgcccttg	Protospacer
**************** ****. **

87. spacer 2.3|1300677|25|NC_009484|CRT matches to MN428048 (Gordonia phage DobbysSock, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccagcgcgcccgcggcacccgaa	Protospacer
***** ********.********  

88. spacer 2.4|1300722|25|NC_009484|CRT matches to MN428048 (Gordonia phage DobbysSock, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccagcgcgcccgcggcacccgaa	Protospacer
***** ********.********  

89. spacer 2.6|1300821|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgccggtggcgcccgtg	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
************ *********.. 

90. spacer 2.6|1300821|25|NC_009484|CRT matches to MK801727 (Gordonia phage ThankyouJordi, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgccggtggcgcccgtg	CRISPR spacer
gcccatcgcgccggtcgcgccggtc	Protospacer
.************** ***** ** 

91. spacer 2.6|1300821|25|NC_009484|CRT matches to MT723938 (Gordonia phage Bunnybear, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgccggtggcgcccgtg	CRISPR spacer
gcccatcgcgccggtcgcgccggtc	Protospacer
.************** ***** ** 

92. spacer 2.6|1300821|25|NC_009484|CRT matches to MK875793 (Gordonia phage WelcomeAyanna, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgccggtggcgcccgtg	CRISPR spacer
gcccatcgcgccggtcgcgccggtc	Protospacer
.************** ***** ** 

93. spacer 2.6|1300821|25|NC_009484|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgccggtggcgcccgtg	CRISPR spacer
tcctatcgcgcctgtggcgcccgtc	Protospacer
 **.******** *********** 

94. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

95. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

96. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

97. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

98. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

99. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

100. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

101. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

102. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

103. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

104. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

105. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

106. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

107. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

108. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

109. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

110. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

111. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

112. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
cccggtggcacccgtggcgccggtc	Protospacer
.***** **.************** 

113. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
acccgttgcgcctgtggcgccggtc	Protospacer
 ** ********.*********** 

114. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
ccaggttgcgcccgtggcgccgctt	Protospacer
.* ******************* * 

115. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

116. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

117. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

118. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgctcctgtggcgccggtc	Protospacer
 ******** **.*********** 

119. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggttgcacctgtggcgccggtc	Protospacer
 ********.**.*********** 

120. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggtggcgcccgtggctccggta	Protospacer
 ***** *********** *****.

121. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

122. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

123. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

124. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

125. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

126. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

127. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

128. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

129. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
atcggctgcgcccgtggcgccggag	Protospacer
 .***.***************** *

130. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
atcggttgcggccgtgtcgccggtg	Protospacer
 .******** ***** ********

131. spacer 2.9|1300992|25|NC_009484|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggtgccgcccgtggcgccggtc	Protospacer
 *****  **************** 

132. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_LR026982 (Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggtggcgcccgcggcgccggtc	Protospacer
 ***** *******.********* 

133. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

134. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgcgccgggggcgccggtt	Protospacer
 *********** * ********* 

135. spacer 2.9|1300992|25|NC_009484|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
cccggctgagcccgtggcgccggtc	Protospacer
.****.** *************** 

136. spacer 2.9|1300992|25|NC_009484|CRT matches to MN694114 (Marine virus AFVG_250M252, complete genome) position: , mismatch: 4, identity: 0.84

tccggttgcgcccgtggcgccggtg	CRISPR spacer
gccggttgctcccgttgcgccggtt	Protospacer
 ******** ***** ******** 

137. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtcgcgcccgtggcacccacg	Protospacer
.*********************.. 

138. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtggcgccagtggcacccgta	Protospacer
.***** ***** *********** 

139. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gccggtcgcgcctgtggcacccgtg	Protospacer
.** ********.*********** 

140. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP042264 (Litoreibacter sp. LN3S51 plasmid unnamed3, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
ccccgtcgcgcccgaggcacccgag	Protospacer
 ************* ********  

141. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtcgcacccgtcgcacccgtt	Protospacer
.********.***** ********.

142. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
cgccgtcgcgcccgtcgcgcccgtc	Protospacer
  ************* **.******

143. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
ctccgtcgcgcccttggcacccatc	Protospacer
 .*********** ********.**

144. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
accggtcgcgcccgtggtacccgcg	Protospacer
*** *************.*****. 

145. spacer 2.11|1301091|25|NC_009484|CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcacccgtc	CRISPR spacer
gaccgtcgcgccggtgccacccgtc	Protospacer
. ********** *** ********

146. spacer 2.14|1301244|25|NC_009484|CRT matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgagccgcctgca	Protospacer
************** * ******..

147. spacer 2.14|1301244|25|NC_009484|CRT matches to MK450426 (Streptomyces phage Euratis, complete genome) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgtgtcgcccttc	Protospacer
**************** ****. * 

148. spacer 2.17|1301415|25|NC_009484|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.84

gcctgtggcacccatcgcgccggtg	CRISPR spacer
gcctgtgccacccatcgcgtcggca	Protospacer
******* ***********.***..

149. spacer 2.17|1301415|25|NC_009484|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 4, identity: 0.84

gcctgtggcacccatcgcgccggtg	CRISPR spacer
gcctgtgccacccatcgcgtcggca	Protospacer
******* ***********.***..

150. spacer 2.21|1301658|25|NC_009484|CRT matches to NZ_AP014803 (Rhodovulum sulfidophilum plasmid Plasmid3 DNA, complete genome, strain: DSM 2351) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgagccgcctgca	Protospacer
************** * ******..

151. spacer 2.21|1301658|25|NC_009484|CRT matches to MK450426 (Streptomyces phage Euratis, complete genome) position: , mismatch: 4, identity: 0.84

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgtgtcgcccttc	Protospacer
**************** ****. * 

152. spacer 2.22|1301703|25|NC_009484|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
ctccaccgcgcccttggcgcccatc	Protospacer
 .***.******* ***********

153. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
ctccaccgcgcccttggcgcccatc	Protospacer
 .***.******* ***********

154. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
ctccaccgcgcccttggcgcccatc	Protospacer
 .***.******* ***********

155. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
taccatcgcggccgtggcgcgcatc	Protospacer
  ******** ********* ****

156. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
ttccaccgcgcccttggcgcccatc	Protospacer
 .***.******* ***********

157. spacer 2.22|1301703|25|NC_009484|CRT matches to KP790011 (Gordonia phage Gsput1, complete genome) position: , mismatch: 4, identity: 0.84

acccatcgcgcccgtggcgcccatc	CRISPR spacer
gcccgtcgcgcccgtagcgcccatg	Protospacer
.***.**********.******** 

158. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgttgcgcctgtc	Protospacer
.** *********** ******** 

159. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgtggcaccggac	Protospacer
******************.** *  

160. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
accggtcgcgcccgtggcacctgtc	Protospacer
.** **************.***** 

161. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtggcgcccgtggcgccggac	Protospacer
****** ************** *  

162. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
atccgtcgcgcccctggcgcctgcg	Protospacer
..*********** *********.*

163. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgtggcacccacg	Protospacer
******************.**...*

164. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtggcgcccgtggcgcccggc	Protospacer
****** **************.*  

165. spacer 2.29|1302162|25|NC_009484|CRT matches to MK686068 (Streptomyces phage RemusLoopin, complete genome) position: , mismatch: 4, identity: 0.84

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccgtcgcgcccgtggctccggtc	Protospacer
.***************** ** ** 

166. spacer 2.3|1300677|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8

acccatcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtcgcgcccgtggcacccacg	Protospacer
.***.*****************.. 

167. spacer 2.4|1300722|25|NC_009484|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8

acccatcgcgcccgtggcacccgtc	CRISPR spacer
gcccgtcgcgcccgtggcacccacg	Protospacer
.***.*****************.. 

168. spacer 2.6|1300821|25|NC_009484|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.8

acccatcgcgccggtggcgcccgtg	CRISPR spacer
acccatctcgccggtggcgccgcaa	Protospacer
******* *************   .

169. spacer 2.9|1300992|25|NC_009484|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.8

tccggttgcgcccgtggcgccggtg	CRISPR spacer
accggtggcgcccgtggcgccgcct	Protospacer
 ***** *************** . 

170. spacer 2.13|1301190|34|NC_009484|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.853

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
gcccgtcgcacccgtcgcgcccgtggtaccggtg	Protospacer
.*************************.*** .* 

171. spacer 2.13|1301190|34|NC_009484|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 5, identity: 0.853

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
gcccgtcgcacccgtcgcgcccgtggtaccggtg	Protospacer
.*************************.*** .* 

172. spacer 2.13|1301190|34|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.853

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
gcccgtcgcacccgtcgcacccgttgcacccgtt	Protospacer
.*****************.***** ******.*.

173. spacer 2.14|1301244|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
****.****************... 

174. spacer 2.21|1301658|25|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

acccgtcgcgcccgtggcgcctgtg	CRISPR spacer
acccatcgcgcccgtggcgcccacc	Protospacer
****.****************... 

175. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_KM017071 (Sphingomonas sp. JE1 plasmid pJE1, complete sequence) position: , mismatch: 5, identity: 0.8

acccatcgcgcccgtggcgcccatc	CRISPR spacer
ctggatcgcgcccgtggcgccgatc	Protospacer
 .  ***************** ***

176. spacer 2.22|1301703|25|NC_009484|CRT matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 5, identity: 0.8

acccatcgcgcccgtggcgcccatc	CRISPR spacer
cttgatcgcgcccttggcgcccatc	Protospacer
 .. ********* ***********

177. spacer 2.29|1302162|25|NC_009484|CRT matches to NZ_LR134469 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 27, complete sequence) position: , mismatch: 5, identity: 0.8

gcccgtcgcgcccgtggcgcctgtg	CRISPR spacer
gcccgtcgcgcccgcggcgccgcga	Protospacer
**************.******   .

178. spacer 2.3|1300677|25|NC_009484|CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 6, identity: 0.76

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccatcgcgcccgtggcaaatact	Protospacer
*******************  ....

179. spacer 2.4|1300722|25|NC_009484|CRT matches to NZ_CP045385 (Ruegeria sp. THAF33 plasmid pTHAF33_a, complete sequence) position: , mismatch: 6, identity: 0.76

acccatcgcgcccgtggcacccgtc	CRISPR spacer
acccatcgcgcccgtggcaaatact	Protospacer
*******************  ....

180. spacer 2.1|1300560|34|NC_009484|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 7, identity: 0.794

acccgt-cgcgccggtggctccggttgcgcccgtg	CRISPR spacer
-cacgtccgcgccggtcgctccggtcgcgccgccg	Protospacer
 * *** ********* ********.*****  .*

181. spacer 2.28|1302108|34|NC_009484|CRT matches to MN116494 (Klebsiella phage vB_KpnP_Bp5, complete genome) position: , mismatch: 7, identity: 0.794

gcccgtggctccagttgcgccggtggcgcccgtg	CRISPR spacer
tccagcagctccagttgcgccagtggctcccgcg	Protospacer
 ** *..**************.***** ****.*

182. spacer 2.5|1300767|34|NC_009484|CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 8, identity: 0.765

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
cgccggtgcgcccgaggcacccggtgcgccggcc	Protospacer
. * * ******** ******** ********. 

183. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_004771 (Pasteurella multocida plasmid pJR1, complete sequence) position: , mismatch: 8, identity: 0.765

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
agctacggctccggttgcgcccgtgacgccggag	Protospacer
  * ..*******************.* **** *

184. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 8, identity: 0.765

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
ggcgacgtcgccggttacgcccgtggcgccggtg	Protospacer
  **..* * ******.********** ******

185. spacer 2.13|1301190|34|NC_009484|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
gcgcgtcgcacccgacgcgcccgtcgccgcggtc	Protospacer
.* *********** ********* **  * .**

186. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_004771 (Pasteurella multocida plasmid pJR1, complete sequence) position: , mismatch: 8, identity: 0.765

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
agctacggctccggttgcgcccgtgacgccggag	Protospacer
  * ..*******************.* **** *

187. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 8, identity: 0.765

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
ggcgacgtcgccggttacgcccgtggcgccggtg	Protospacer
  **..* * ******.********** ******

188. spacer 2.5|1300767|34|NC_009484|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
ggcgcaggcgcccgtggcgcccgtggcgccggac	Protospacer
  **   ***********.***** *******  

189. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP017783 (Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

190. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP017784 (Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

191. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

192. spacer 2.7|1300866|34|NC_009484|CRT matches to MT081181 (Uncultured bacterium plasmid pCu_H_1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

193. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

194. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

195. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

196. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

197. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

198. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

199. spacer 2.7|1300866|34|NC_009484|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

200. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

201. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

202. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

203. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

204. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

205. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

206. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

207. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

208. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

209. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP010723 (Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

210. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

211. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

212. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

213. spacer 2.7|1300866|34|NC_009484|CRT matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

214. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

215. spacer 2.7|1300866|34|NC_009484|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

216. spacer 2.7|1300866|34|NC_009484|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

217. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

218. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

219. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

220. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

221. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

222. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

223. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

224. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

225. spacer 2.7|1300866|34|NC_009484|CRT matches to MT011984 (Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

226. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

227. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

228. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

229. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

230. spacer 2.7|1300866|34|NC_009484|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

231. spacer 2.7|1300866|34|NC_009484|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

232. spacer 2.7|1300866|34|NC_009484|CRT matches to MN369759 (Mycobacterium phage Mithril, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

233. spacer 2.7|1300866|34|NC_009484|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

234. spacer 2.7|1300866|34|NC_009484|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

235. spacer 2.7|1300866|34|NC_009484|CRT matches to MK524486 (Mycobacterium phage Waleliano, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

236. spacer 2.7|1300866|34|NC_009484|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

237. spacer 2.7|1300866|34|NC_009484|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

238. spacer 2.7|1300866|34|NC_009484|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

239. spacer 2.7|1300866|34|NC_009484|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

240. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

241. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

242. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtgaccgtc	Protospacer
  ***** * ****************.  * ** 

243. spacer 2.7|1300866|34|NC_009484|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtgaccgtc	Protospacer
  ***** * ****************.  * ** 

244. spacer 2.7|1300866|34|NC_009484|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

245. spacer 2.7|1300866|34|NC_009484|CRT matches to NC_028968 (Mycobacterium phage BrownCNA, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

246. spacer 2.13|1301190|34|NC_009484|CRT matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
atggcgggcacccatcgcgcccgtggcgcccacc	Protospacer
*.     ******.*************.****.*

247. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP017783 (Rhodobacter sp. LPB0142 plasmid pEJ02, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

248. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP017784 (Rhodobacter sp. LPB0142 plasmid pEJ03, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

249. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

250. spacer 2.15|1301289|34|NC_009484|CRT matches to MT081181 (Uncultured bacterium plasmid pCu_H_1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

251. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP049911 (Diaphorobacter sp. HDW4A plasmid p_unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

252. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP025470 (Klebsiella pneumoniae strain JS187 plasmid p187-4, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

253. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_022078 (Klebsiella pneumoniae JM45 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

254. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP039989 (Pseudomonas aeruginosa strain T2436 plasmid pBT2436, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

255. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP027038 (Klebsiella pneumoniae strain 16_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

256. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP027055 (Klebsiella pneumoniae strain 2_GR_12 plasmid IncAC2) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

257. spacer 2.15|1301289|34|NC_009484|CRT matches to CP052444 (Klebsiella pneumoniae strain C16KP0098 plasmid pC16KP0098-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

258. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP030080 (Enterobacter hormaechei strain 20710 plasmid pIMP-20710, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

259. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

260. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP039991 (Pseudomonas aeruginosa strain T2101 plasmid pBT2101, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

261. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

262. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP031802 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

263. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP028996 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

264. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP040034 (Klebsiella pneumoniae strain KPC160117 plasmid pIncC-L117, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

265. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP027043 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncAC2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

266. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP011571 (Enterobacter hormaechei strain CAV1311 plasmid pKPC_CAV1311, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

267. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP010723 (Phaeobacter piscinae strain P18 plasmid pP18_h, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

268. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP017084 (Proteus mirabilis strain T21 plasmid pT212, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

269. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP040029 (Klebsiella pneumoniae strain KPC160121 plasmid pIncC-L121, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

270. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP031122 (Providencia sp. WCHPHu000369 strain WCHPr000369 plasmid pIMP69_000369, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

271. spacer 2.15|1301289|34|NC_009484|CRT matches to MG879028 (Uncultured bacterium plasmid pEG1-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

272. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

273. spacer 2.15|1301289|34|NC_009484|CRT matches to MN823999 (Klebsiella pneumoniae strain 362713 plasmid p362713-FIIK, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

274. spacer 2.15|1301289|34|NC_009484|CRT matches to MN842293 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-1FIIK, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

275. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP011580 (Enterobacter hormaechei strain CAV1411 plasmid pKPC_CAV1411, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

276. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP013115 (Shewanella xiamenensis strain T17 plasmid pSx1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

277. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

278. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP011583 (Enterobacter hormaechei strain CAV1668 plasmid pCAV1668-85, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

279. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP011649 (Enterobacter hormaechei strain CAV1669 plasmid pKPC_CAV1669, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

280. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_016839 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS3, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

281. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP027695 (Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

282. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_MH917284 (Klebsiella pneumoniae strain 397108 plasmid p397108-Ct2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

283. spacer 2.15|1301289|34|NC_009484|CRT matches to MT011984 (Comamonas testosteroni strain NFYY023 plasmid pNFYY023-1, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

284. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_MF344574 (Enterobacter hormaechei strain T5282 plasmid pT5282-Ct2, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

285. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_CP030132 (Klebsiella pneumoniae strain 160111 plasmid pIncAC2_L111, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

286. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_MF150084 (Klebsiella pneumoniae strain A64477 plasmid pKP64477a, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

287. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_KY883660 (Pseudomonas putida strain SY153 plasmid pSY153-MDR, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

288. spacer 2.15|1301289|34|NC_009484|CRT matches to NZ_MF150118 (Proteus mirabilis strain A64421 plasmid pPM64421a, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
tgctacagctccggttgcgcccgtgacgccggac	Protospacer
* * ...******************.* ****  

289. spacer 2.15|1301289|34|NC_009484|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

290. spacer 2.15|1301289|34|NC_009484|CRT matches to MN369759 (Mycobacterium phage Mithril, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

291. spacer 2.15|1301289|34|NC_009484|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

292. spacer 2.15|1301289|34|NC_009484|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

293. spacer 2.15|1301289|34|NC_009484|CRT matches to MK524486 (Mycobacterium phage Waleliano, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

294. spacer 2.15|1301289|34|NC_009484|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

295. spacer 2.15|1301289|34|NC_009484|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

296. spacer 2.15|1301289|34|NC_009484|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

297. spacer 2.15|1301289|34|NC_009484|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

298. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

299. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

300. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtgaccgtc	Protospacer
  ***** * ****************.  * ** 

301. spacer 2.15|1301289|34|NC_009484|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtgaccgtc	Protospacer
  ***** * ****************.  * ** 

302. spacer 2.15|1301289|34|NC_009484|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

303. spacer 2.15|1301289|34|NC_009484|CRT matches to NC_028968 (Mycobacterium phage BrownCNA, complete genome) position: , mismatch: 9, identity: 0.735

tccggtggctccggttgcgcccgtggctccggtg	CRISPR spacer
gacggtgccgccggttgcgcccgtggtcaccgtc	Protospacer
  ***** * ****************.. * ** 

304. spacer 2.5|1300767|34|NC_009484|CRT matches to NZ_AP019743 (Acinetobacter radioresistens DSM 6976 = NBRC 102413 = CIP 103788 strain NBRC 102413 plasmid pARA3, complete sequence) position: , mismatch: 11, identity: 0.676

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
aacggttgcgcctgtgtcacccgttgcttgacct	Protospacer
  **********.*** ********** . . . 

305. spacer 2.5|1300767|34|NC_009484|CRT matches to NZ_CP022285 (Acinetobacter baumannii strain 7804 plasmid pAba7804b, complete sequence) position: , mismatch: 11, identity: 0.676

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
aacggttgcgcctgtgtcacccgttgcttgacct	Protospacer
  **********.*** ********** . . . 

306. spacer 2.5|1300767|34|NC_009484|CRT matches to MK531536 (Acinetobacter baumannii strain MC1 plasmid pMC1.1, complete sequence) position: , mismatch: 11, identity: 0.676

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
aacggttgcgcctgtgtcacccgttgcttgacct	Protospacer
  **********.*** ********** . . . 

307. spacer 2.5|1300767|34|NC_009484|CRT matches to NZ_CP014652 (Acinetobacter sp. DUT-2 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676

tccggttgcgcccgtggcacccgttgcgccggtg	CRISPR spacer
aacggttgcgcctgtgtcacccgttgcttgacct	Protospacer
  **********.*** ********** . . . 

308. spacer 2.12|1301136|34|NC_009484|CRT matches to NZ_CP010857 (Marinovum algicola DG 898 plasmid pMaD2, complete sequence) position: , mismatch: 11, identity: 0.676

tccggtcgcacccatcgcgcccgttgcgccggtg	CRISPR spacer
gtgcgaggcacccatcgcgcccgtggcggcgacc	Protospacer
 .  *  ***************** *** **.. 

309. spacer 2.13|1301190|34|NC_009484|CRT matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 11, identity: 0.676

acccgtcgcacccgtcgcgcccgtggcacccatc	CRISPR spacer
gatggccgcacccgtcgcgaccgcggcaccgtag	Protospacer
. . *.************* ***.******    

310. spacer 2.28|1302108|34|NC_009484|CRT matches to NZ_CP039918 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626a, complete sequence) position: , mismatch: 11, identity: 0.676

gcccgtggctccagttgcgccggtggcgcccgtg	CRISPR spacer
cgccgtggctccagatgcgccgctggttttcagc	Protospacer
  ************ ******* ***. ..*.  

311. spacer 2.28|1302108|34|NC_009484|CRT matches to NZ_CP048633 (Rhizobium oryzihabitans strain M15 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676

gcccgtggctccagttgcgccggtggcgcccgtg	CRISPR spacer
cgccgtggctccagatgcgccgctggttttcagc	Protospacer
  ************ ******* ***. ..*.  

312. spacer 2.28|1302108|34|NC_009484|CRT matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 11, identity: 0.676

gcccgtggctccagttgcgccggtggcgcccgtg	CRISPR spacer
cgccgtggctccagatgcgccgctggttttcagc	Protospacer
  ************ ******* ***. ..*.  

313. spacer 2.28|1302108|34|NC_009484|CRT matches to NZ_KY000062 (Agrobacterium genomosp. 3 strain CFBP4424 plasmid pTi_CFBP4424, complete sequence) position: , mismatch: 11, identity: 0.676

gcccgtggctccagttgcgccggtggcgcccgtg	CRISPR spacer
cgccgtggctccagatgcgccgctggttttcagc	Protospacer
  ************ ******* ***. ..*.  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 865695 : 887985 16 Stx2-converting_phage(40.0%) transposase NA
DBSCAN-SWA_2 2533449 : 2596657 55 Acidithiobacillus_phage(12.5%) transposase,integrase attL 2567939:2567957|attR 2597501:2597519
DBSCAN-SWA_3 2749998 : 2797600 51 uncultured_virus(45.45%) terminase,tRNA,protease,portal,tail,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. NC_009467
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009467_1 157782-157905 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009467_1 1.1|157807|23|NC_009467|CRISPRCasFinder 157807-157829 23 NC_009467.1 157775-157797 0 1.0
NC_009467_1 1.2|157855|26|NC_009467|CRISPRCasFinder 157855-157880 26 NC_009468.1 106040-106065 0 1.0

1. spacer 1.1|157807|23|NC_009467|CRISPRCasFinder matches to position: 157775-157797, mismatch: 0, identity: 1.0

ttggagcggggagtagcgggcaa	CRISPR spacer
ttggagcggggagtagcgggcaa	Protospacer
***********************

2. spacer 1.2|157855|26|NC_009467|CRISPRCasFinder matches to position: 106040-106065, mismatch: 0, identity: 1.0

gtcgggcgcggatgacggatgagatc	CRISPR spacer
gtcgggcgcggatgacggatgagatc	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009467_1 1.1|157807|23|NC_009467|CRISPRCasFinder 157807-157829 23 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 157775-157797 0 1.0
NC_009467_1 1.1|157807|23|NC_009467|CRISPRCasFinder 157807-157829 23 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 157807-157829 0 1.0
NC_009467_1 1.2|157855|26|NC_009467|CRISPRCasFinder 157855-157880 26 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 106040-106065 0 1.0
NC_009467_1 1.2|157855|26|NC_009467|CRISPRCasFinder 157855-157880 26 NC_009467 Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence 157855-157880 0 1.0
NC_009467_1 1.2|157855|26|NC_009467|CRISPRCasFinder 157855-157880 26 NC_009468 Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence 105989-106014 2 0.923

1. spacer 1.1|157807|23|NC_009467|CRISPRCasFinder matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 0, identity: 1.0

ttggagcggggagtagcgggcaa	CRISPR spacer
ttggagcggggagtagcgggcaa	Protospacer
***********************

2. spacer 1.1|157807|23|NC_009467|CRISPRCasFinder matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 0, identity: 1.0

ttggagcggggagtagcgggcaa	CRISPR spacer
ttggagcggggagtagcgggcaa	Protospacer
***********************

3. spacer 1.2|157855|26|NC_009467|CRISPRCasFinder matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgggcgcggatgacggatgagatc	CRISPR spacer
gtcgggcgcggatgacggatgagatc	Protospacer
**************************

4. spacer 1.2|157855|26|NC_009467|CRISPRCasFinder matches to NC_009467 (Acidiphilium cryptum JF-5 plasmid pACRY01, complete sequence) position: , mismatch: 0, identity: 1.0

gtcgggcgcggatgacggatgagatc	CRISPR spacer
gtcgggcgcggatgacggatgagatc	Protospacer
**************************

5. spacer 1.2|157855|26|NC_009467|CRISPRCasFinder matches to NC_009468 (Acidiphilium cryptum JF-5 plasmid pACRY02, complete sequence) position: , mismatch: 2, identity: 0.923

gtcgggcgcggatgacggatgagatc	CRISPR spacer
gtcgggcgcggatgacggatgagagg	Protospacer
************************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9867 : 85164 49 Streptococcus_phage(18.18%) transposase NA
DBSCAN-SWA_2 94195 : 161017 57 Corynebacterium_phage(13.33%) transposase NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
NC_009467.1|WP_155856283.1|125943_126285_+|hypothetical-protein 125943_126285_+ 113 aa aa NA NA NA 94195-161017 yes
NC_009467.1|WP_043508786.1|126526_126730_-|hypothetical-protein 126526_126730_- 67 aa aa NA NA NA 94195-161017 yes
5. NC_009470
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009470_1 25677-25888 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009470_1 1.1|25707|31|NC_009470|PILER-CR 25707-25737 31 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25707-25737 0 1.0
NC_009470_1 1.2|25768|31|NC_009470|PILER-CR 25768-25798 31 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25768-25798 0 1.0
NC_009470_1 1.3|25701|37|NC_009470|CRISPRCasFinder 25701-25737 37 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25701-25737 0 1.0
NC_009470_1 1.4|25762|37|NC_009470|CRISPRCasFinder 25762-25798 37 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25762-25798 0 1.0
NC_009470_1 1.5|25823|37|NC_009470|CRISPRCasFinder 25823-25859 37 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25823-25859 0 1.0
NC_009470_1 1.6|25706|32|NC_009470|CRT 25706-25737 32 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25706-25737 0 1.0
NC_009470_1 1.7|25767|32|NC_009470|CRT 25767-25798 32 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25767-25798 0 1.0
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NC_009470 Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence 25828-25859 0 1.0
NC_009470_1 1.1|25707|31|NC_009470|PILER-CR 25707-25737 31 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 214490-214520 7 0.774
NC_009470_1 1.1|25707|31|NC_009470|PILER-CR 25707-25737 31 CP006583 Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence 53243-53273 8 0.742
NC_009470_1 1.6|25706|32|NC_009470|CRT 25706-25737 32 NZ_LT985249 Escherichia coli strain 195 plasmid RCS46_p, complete sequence 214489-214520 8 0.75
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NZ_CP006990 Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence 575656-575687 8 0.75
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 690712-690743 8 0.75
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NZ_CP021127 Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence 525270-525301 8 0.75
NC_009470_1 1.6|25706|32|NC_009470|CRT 25706-25737 32 CP006583 Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence 53242-53273 9 0.719
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 849970-850001 9 0.719
NC_009470_1 1.8|25828|32|NC_009470|CRT 25828-25859 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 924843-924874 9 0.719

1. spacer 1.1|25707|31|NC_009470|PILER-CR matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

gcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
gcctcggccagtatgtgatcgcggcgatcgt	Protospacer
*******************************

2. spacer 1.2|25768|31|NC_009470|PILER-CR matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

tgaacatcatagactttcaccgtcaccgaaa	CRISPR spacer
tgaacatcatagactttcaccgtcaccgaaa	Protospacer
*******************************

3. spacer 1.3|25701|37|NC_009470|CRISPRCasFinder matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

aaccgcgcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
aaccgcgcctcggccagtatgtgatcgcggcgatcgt	Protospacer
*************************************

4. spacer 1.4|25762|37|NC_009470|CRISPRCasFinder matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

aaccgctgaacatcatagactttcaccgtcaccgaaa	CRISPR spacer
aaccgctgaacatcatagactttcaccgtcaccgaaa	Protospacer
*************************************

5. spacer 1.5|25823|37|NC_009470|CRISPRCasFinder matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

aaccgaaagacgccggcaattcagccgccgctcattg	CRISPR spacer
aaccgaaagacgccggcaattcagccgccgctcattg	Protospacer
*************************************

6. spacer 1.6|25706|32|NC_009470|CRT matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

cgcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
cgcctcggccagtatgtgatcgcggcgatcgt	Protospacer
********************************

7. spacer 1.7|25767|32|NC_009470|CRT matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

ctgaacatcatagactttcaccgtcaccgaaa	CRISPR spacer
ctgaacatcatagactttcaccgtcaccgaaa	Protospacer
********************************

8. spacer 1.8|25828|32|NC_009470|CRT matches to NC_009470 (Acidiphilium cryptum JF-5 plasmid pACRY04, complete sequence) position: , mismatch: 0, identity: 1.0

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
aaagacgccggcaattcagccgccgctcattg	Protospacer
********************************

9. spacer 1.1|25707|31|NC_009470|PILER-CR matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 7, identity: 0.774

gcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
ccatcggcccgtatgtgatcccggcgattaa	Protospacer
 * ****** ********** *******.. 

10. spacer 1.1|25707|31|NC_009470|PILER-CR matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 8, identity: 0.742

gcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
ccatcggccaggatgtgttcgcggcgtgctc	Protospacer
 * ******** ***** ********  * .

11. spacer 1.6|25706|32|NC_009470|CRT matches to NZ_LT985249 (Escherichia coli strain 195 plasmid RCS46_p, complete sequence) position: , mismatch: 8, identity: 0.75

cgcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
gccatcggcccgtatgtgatcccggcgattaa	Protospacer
  * ****** ********** *******.. 

12. spacer 1.8|25828|32|NC_009470|CRT matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.75

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
tgagacgcgggcaattcagctgccgggcaacg	Protospacer
 .****** ***********.****  ** .*

13. spacer 1.8|25828|32|NC_009470|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 8, identity: 0.75

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
tgagacgcgggcaattcagctgccgggcaacg	Protospacer
 .****** ***********.****  ** .*

14. spacer 1.8|25828|32|NC_009470|CRT matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 8, identity: 0.75

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
tgagacgcgggcaattcagctgccgggcaacg	Protospacer
 .****** ***********.****  ** .*

15. spacer 1.6|25706|32|NC_009470|CRT matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 9, identity: 0.719

cgcctcggccagtatgtgatcgcggcgatcgt	CRISPR spacer
gccatcggccaggatgtgttcgcggcgtgctc	Protospacer
  * ******** ***** ********  * .

16. spacer 1.8|25828|32|NC_009470|CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
ttcgctgccggcaattcagccgccgggcatac	Protospacer
   * .*******************  ***  

17. spacer 1.8|25828|32|NC_009470|CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719

aaagacgccggcaattcagccgccgctcattg	CRISPR spacer
ttcgctgccggcaattcagccgccgggcatac	Protospacer
   * .*******************  ***  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13257 : 22942 6 Salmonella_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage