Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009565 Mycobacterium tuberculosis F11, complete genome 15 crisprs csa3,c2c9_V-U4,cas3,DinG,WYL,cas4,DEDDh,cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6 11 35 2 0

Results visualization

1. NC_009565
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_1 369604-370302 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_2 634510-634647 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_3 695253-695329 TypeV-U4 NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_4 788327-788482 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_5 929131-930033 Orphan NA
18 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_6 1195086-1195194 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_7 1576526-1577598 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_8 2096485-2096739 Orphan NA
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_9 2177069-2177288 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_10 3131140-3132494 TypeIII II-B,III-A
18 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_11 3133859-3135205 TypeIII II-B,III-A
18 spacers
cas2,cas1,csm6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_12 3753072-3753751 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_13 3859276-3859365 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_14 3961544-3962174 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009565_15 4123679-4123767 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009565_14 14.4|3961806|47|NC_009565|CRT 3961806-3961852 47 NC_009565.1 3962394-3962440 0 1.0
NC_009565_14 14.5|3961878|59|NC_009565|CRT 3961878-3961936 59 NC_009565.1 3962466-3962524 0 1.0
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NC_009565.1 3962550-3962596 0 1.0
NC_009565_2 2.1|634528|18|NC_009565|CRT 634528-634545 18 NC_009565.1 22567-22584 1 0.944
NC_009565_2 2.1|634528|18|NC_009565|CRT 634528-634545 18 NC_009565.1 1415833-1415850 1 0.944
NC_009565_2 2.3|634612|18|NC_009565|CRT 634612-634629 18 NC_009565.1 977064-977081 1 0.944
NC_009565_8 8.2|2096566|18|NC_009565|CRT 2096566-2096583 18 NC_009565.1 404142-404159 1 0.944
NC_009565_8 8.2|2096566|18|NC_009565|CRT 2096566-2096583 18 NC_009565.1 610565-610582 1 0.944
NC_009565_8 8.4|2096656|18|NC_009565|CRT 2096656-2096673 18 NC_009565.1 3461962-3461979 1 0.944
NC_009565_1 1.5|369892|42|NC_009565|CRISPRCasFinder 369892-369933 42 NC_009565.1 377863-377904 2 0.952
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NC_009565.1 376678-376710 2 0.939
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 NC_009565.1 678321-678356 2 0.944
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 NC_009565.1 1217516-1217551 2 0.944
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 NC_009565.1 2437318-2437353 2 0.944
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NC_009565.1 1215812-1215833 2 0.909

1. spacer 14.4|3961806|47|NC_009565|CRT matches to position: 3962394-3962440, mismatch: 0, identity: 1.0

caaggcggcgccgggggtgctggcatcagcttcagcaacggcagcaa	CRISPR spacer
caaggcggcgccgggggtgctggcatcagcttcagcaacggcagcaa	Protospacer
***********************************************

2. spacer 14.5|3961878|59|NC_009565|CRT matches to position: 3962466-3962524, mismatch: 0, identity: 1.0

gtgggcggcaccgggggcgacggcggcaacgcaggcaccggcgccggcgaccccggcaa	CRISPR spacer
gtgggcggcaccgggggcgacggcggcaacgcaggcaccggcgccggcgaccccggcaa	Protospacer
***********************************************************

3. spacer 14.6|3961962|47|NC_009565|CRT matches to position: 3962550-3962596, mismatch: 0, identity: 1.0

accggcggcagcggcggggccggcggtagcggcggggccaacttcaa	CRISPR spacer
accggcggcagcggcggggccggcggtagcggcggggccaacttcaa	Protospacer
***********************************************

4. spacer 2.1|634528|18|NC_009565|CRT matches to position: 22567-22584, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acgacgtcggcgacgacg	Protospacer
** ***************

5. spacer 2.1|634528|18|NC_009565|CRT matches to position: 1415833-1415850, mismatch: 1, identity: 0.944

accacgtcggcgacgacg	CRISPR spacer
acctcgtcggcgacgacg	Protospacer
*** **************

6. spacer 2.3|634612|18|NC_009565|CRT matches to position: 977064-977081, mismatch: 1, identity: 0.944

accacgccgccaacgacg	CRISPR spacer
accacgccgcccacgacg	Protospacer
*********** ******

7. spacer 8.2|2096566|18|NC_009565|CRT matches to position: 404142-404159, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

8. spacer 8.2|2096566|18|NC_009565|CRT matches to position: 610565-610582, mismatch: 1, identity: 0.944

gatcagcccgacggcgtt	CRISPR spacer
gatcagcccgtcggcgtt	Protospacer
********** *******

9. spacer 8.4|2096656|18|NC_009565|CRT matches to position: 3461962-3461979, mismatch: 1, identity: 0.944

gatcagcgtcccgccggt	CRISPR spacer
gatcagcgtcccgctggt	Protospacer
**************.***

10. spacer 1.5|369892|42|NC_009565|CRISPRCasFinder matches to position: 377863-377904, mismatch: 2, identity: 0.952

ccggtgcccgagttgaagaacccgatgtttccgctgccggag	CRISPR spacer
ccggtgcccgagttgaacaacccgacgtttccgctgccggag	Protospacer
***************** *******.****************

11. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to position: 376678-376710, mismatch: 2, identity: 0.939

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
aggctgccgaacccgatctggccgctgccggtg	Protospacer
********** *************.********

12. spacer 5.16|929869|36|NC_009565|CRT matches to position: 678321-678356, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatgggcaacggcggcaacggcggggccggcgg	Protospacer
****** ***********.*****************

13. spacer 5.16|929869|36|NC_009565|CRT matches to position: 1217516-1217551, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggccacggcggggccggcgg	Protospacer
******************. ****************

14. spacer 5.16|929869|36|NC_009565|CRT matches to position: 2437318-2437353, mismatch: 2, identity: 0.944

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gctgatcggcaacggcggcaacggcggtgccggcgg	Protospacer
******************.******** ********

15. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to position: 1215812-1215833, mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gttgccgatcagcccggcggca	Protospacer
**.********* *********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1975819-1975840 1 0.955
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1109892-1109913 1 0.955
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP016457 Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence 87869-87890 1 0.955
NC_009565_7 7.15|1577545|22|NC_009565|CRISPRCasFinder 1577545-1577566 22 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 362668-362689 1 0.955
NC_009565_7 7.15|1577545|22|NC_009565|CRISPRCasFinder 1577545-1577566 22 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2289382-2289403 1 0.955
NC_009565_7 7.15|1577545|22|NC_009565|CRISPRCasFinder 1577545-1577566 22 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 81656-81677 1 0.955
NC_009565_7 7.15|1577545|22|NC_009565|CRISPRCasFinder 1577545-1577566 22 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 56160-56181 1 0.955
NC_009565_7 7.2|1576618|22|NC_009565|CRISPRCasFinder 1576618-1576639 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 881140-881161 2 0.909
NC_009565_7 7.2|1576618|22|NC_009565|CRISPRCasFinder 1576618-1576639 22 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 225972-225993 2 0.909
NC_009565_7 7.2|1576618|22|NC_009565|CRISPRCasFinder 1576618-1576639 22 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 451168-451189 2 0.909
NC_009565_7 7.2|1576618|22|NC_009565|CRISPRCasFinder 1576618-1576639 22 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 234992-235013 2 0.909
NC_009565_7 7.2|1576618|22|NC_009565|CRISPRCasFinder 1576618-1576639 22 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 597449-597470 2 0.909
NC_009565_7 7.3|1576672|22|NC_009565|CRISPRCasFinder 1576672-1576693 22 NZ_CP025510 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence 117076-117097 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP021032 Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence 448838-448859 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 160471-160492 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP021028 Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence 175264-175285 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 457593-457614 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013503 Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence 166709-166730 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013509 Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence 166709-166730 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013520 Rhizobium sp. N113 plasmid pRspN113c, complete sequence 166709-166730 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013493 Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence 166709-166730 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013516 Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence 164465-164486 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 97458-97479 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP012698 Microbacterium sp. No. 7 plasmid A, complete sequence 53118-53139 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 100830-100851 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 307854-307875 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 23841-23862 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 279961-279982 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 359201-359222 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 606826-606847 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 411558-411579 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP054029 Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence 300111-300132 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 483830-483851 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP024312 Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence 68146-68167 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 CP042595 Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence 175112-175133 2 0.909
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 314082-314103 2 0.909
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 402883-402907 2 0.92
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 416172-416196 2 0.92
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 472935-472959 2 0.92
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4024254-4024277 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4460576-4460599 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP034768 Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence 122201-122224 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 37773-37796 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 116652-116675 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_AP019631 Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence 72348-72371 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 KU716094 Mycobacterium phage Eidsmoe, complete genome 5649-5672 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MH371122 Mycobacterium phage Priya, complete genome 5650-5673 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MK016502 Mycobacterium phage Pat3, complete genome 22827-22850 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MK937593 Mycobacterium phage Flypotenuse, complete genome 23717-23740 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MG872835 Mycobacterium phage Conquerage, complete genome 5649-5672 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MH536820 Mycobacterium phage Glexan, complete genome 23717-23740 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 91001-91024 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP013426 Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence 44795-44818 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1701753-1701776 3 0.875
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MH271298 Microbacterium phage Floof, complete genome 37939-37962 3 0.875
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_KY349138 Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence 9264-9285 3 0.864
NC_009565_7 7.4|1576726|22|NC_009565|CRISPRCasFinder 1576726-1576747 22 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 13233-13254 3 0.864
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 937294-937318 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP022999 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence 1470762-1470786 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 MN586053 Arthrobacter phage BeatusComedenti, complete genome 26689-26713 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NC_031254 Arthrobacter phage Kitkat, complete genome 26809-26833 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NC_031231 Arthrobacter phage KellEzio, complete genome 26691-26715 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 633177-633201 3 0.88
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP030129 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence 74124-74148 3 0.88
NC_009565_7 7.15|1577545|22|NC_009565|CRISPRCasFinder 1577545-1577566 22 NC_008270 Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence 380879-380900 3 0.864
NC_009565_8 8.5|2096695|24|NC_009565|CRT 2096695-2096718 24 NZ_CP049158 Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence 1555522-1555545 3 0.875
NC_009565_8 8.5|2096695|24|NC_009565|CRT 2096695-2096718 24 NZ_CP049318 Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence 1560190-1560213 3 0.875
NC_009565_1 1.1|369637|27|NC_009565|CRISPRCasFinder 369637-369663 27 NC_023591 Mycobacterium phage Adler, complete genome 61249-61275 4 0.852
NC_009565_1 1.1|369637|27|NC_009565|CRISPRCasFinder 369637-369663 27 KF981876 UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome 61247-61273 4 0.852
NC_009565_1 1.7|370033|27|NC_009565|CRISPRCasFinder 370033-370059 27 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 10066-10092 4 0.852
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 460464-460490 4 0.852
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NC_016652 Rhodococcus phage REQ2, complete genome 36035-36061 4 0.852
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 603744-603773 4 0.867
NC_009565_4 4.1|788366|24|NC_009565|PILER-CR 788366-788389 24 MK686069 Streptomyces phage Heather, complete genome 28542-28565 4 0.833
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 KY945355 Mycobacterium phage Shandong1, complete genome 25634-25660 4 0.852
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP015095 Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence 106725-106751 4 0.852
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NC_041888 Mycobacterium phage Tortellini, complete genome 37216-37242 4 0.852
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 1096460-1096489 4 0.867
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1898211-1898234 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 261506-261529 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 673134-673157 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP016822 Rhodococcus sp. p52 plasmid pDF03, complete sequence 60076-60099 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MN582086 Siphoviridae sp. ctdEk19, complete genome 33324-33347 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MF919502 Mycobacterium phage Demsculpinboyz, complete genome 21980-22003 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MT889380 Mycobacterium phage Coco12, complete genome 22623-22646 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NC_023698 Mycobacterium phage Avani, complete genome 21987-22010 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MT114167 Mycobacterium phage Phanphagia, complete genome 22278-22301 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP050953 Rhodococcus sp. DMU1 plasmid unnamed 558871-558894 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1500559-1500582 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 295932-295955 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NC_015583 Novosphingobium sp. PP1Y plasmid Mpl, complete sequence 1116335-1116358 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MN096355 Mycobacterium phage Purky, complete genome 48975-48998 4 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 MK279853 Gordonia phage Gray, complete genome 68404-68427 4 0.833
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 818773-818800 4 0.857
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 420542-420569 4 0.857
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 77799-77826 4 0.857
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 176640-176664 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 29428-29452 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 38191-38215 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 MT553342 Microbacterium phage Kelcole, complete genome 51573-51597 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NC_048068 Microbacterium phage OneinaGillian, complete genome 50894-50918 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 MT310894 Microbacterium phage Tempo, complete genome 51697-51721 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP047175 Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence 42080-42104 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 67777-67801 4 0.84
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 MN034284 Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence 624-648 4 0.84
NC_009565_7 7.14|1577488|25|NC_009565|CRISPRCasFinder 1577488-1577512 25 MN582064 Podoviridae sp. ctka020, complete genome 29274-29298 4 0.84
NC_009565_8 8.5|2096695|24|NC_009565|CRT 2096695-2096718 24 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 680430-680453 4 0.833
NC_009565_8 8.5|2096695|24|NC_009565|CRT 2096695-2096718 24 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5913119-5913142 4 0.833
NC_009565_8 8.5|2096695|24|NC_009565|CRT 2096695-2096718 24 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 143186-143209 4 0.833
NC_009565_1 1.1|369637|27|NC_009565|CRISPRCasFinder 369637-369663 27 LR794124 Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1 34861-34887 5 0.815
NC_009565_1 1.1|369637|27|NC_009565|CRISPRCasFinder 369637-369663 27 NC_012662 Vibrio phage VP93, complete genome 35301-35327 5 0.815
NC_009565_1 1.7|370033|27|NC_009565|CRISPRCasFinder 370033-370059 27 NZ_CP016084 Streptomyces sp. SAT1 plasmid unnamed4, complete sequence 2189-2215 5 0.815
NC_009565_1 1.7|370033|27|NC_009565|CRISPRCasFinder 370033-370059 27 MN693945 Marine virus AFVG_250M952, complete genome 34909-34935 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 369429-369455 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 338832-338858 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013554 Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence 363377-363403 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP015368 Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence 104717-104743 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 338543-338569 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013560 Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence 340811-340837 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 342690-342716 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 343060-343086 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 355714-355740 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 343060-343086 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 348335-348361 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 343052-343078 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP020444 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence 69464-69490 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013565 Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence 363377-363403 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 355714-355740 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 342690-342716 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 10340-10366 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 19365-19391 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MN586031 Gordonia phage Gambino, complete genome 3053-3079 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 KU998236 Gordonia phage Blueberry, complete genome 3053-3079 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MN062704 Gordonia phage JuJu, complete genome 3063-3089 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MK501729 Gordonia phage Walrus, complete genome 3053-3079 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NC_031226 Gordonia phage BaxterFox, complete genome 2982-3008 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MK967393 Rhodococcus phage Whack, complete genome 3063-3089 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MT723935 Gordonia phage Azula, complete genome 3053-3079 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 KU963249 Gordonia phage Yeezy, complete genome 2982-3008 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MH153808 Gordonia phage Petra, complete genome 3053-3079 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MT639650 Gordonia phage Ohgeesy, complete genome 2982-3008 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MH536818 Gordonia phage Frokostdame, complete genome 3055-3081 5 0.815
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 KX557275 Gordonia phage CarolAnn, complete genome 3052-3078 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 1800-1826 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP022264 Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence 136919-136945 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 658056-658082 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1514868-1514894 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5852040-5852066 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP049908 Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence 235006-235032 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_CP049700 Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence 263243-263269 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 MH576962 Streptomyces phage Satis, complete genome 95306-95332 5 0.815
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 MK620894 Streptomyces phage Kradal, complete genome 95310-95336 5 0.815
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1068923-1068952 5 0.833
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP024314 Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence 1739900-1739929 5 0.833
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233389-233418 5 0.833
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP031193 Humibacter sp. BT305 plasmid unnamed1 44938-44967 5 0.833
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 137673-137702 5 0.833
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 984252-984281 5 0.833
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1598936-1598965 5 0.833
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013631 Rhizobium sp. N324 plasmid pRspN324a, complete sequence 233398-233427 5 0.833
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP046705 Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence 292905-292934 5 0.833
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 AY950802 Haloarcula phage SH1, complete genome 16104-16133 5 0.833
NC_009565_5 5.15|929827|24|NC_009565|CRT 929827-929850 24 NC_006911 Streptomyces sp. F11 plasmid pFP11, complete sequence 11649-11672 5 0.792
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_LN907828 Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence 94483-94510 5 0.821
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 KU728633 Mycobacterium phage Bipper, complete genome 41992-42019 5 0.821
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 MK977701 Mycobacterium phage Cracklewink, complete genome 41985-42012 5 0.821
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_CP016354 Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence 100320-100347 5 0.821
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP025013 Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence 614111-614135 5 0.8
NC_009565_7 7.5|1576780|25|NC_009565|CRISPRCasFinder 1576780-1576804 25 NZ_CP020331 Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence 92705-92729 5 0.8
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_018746 Pseudomonas putida ND6 plasmid pND6-2, complete sequence 45440-45470 5 0.839
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 MN961671 Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence 123562-123592 5 0.839
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 MN961672 Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence 72551-72581 5 0.839
NC_009565_7 7.13|1577422|34|NC_009565|CRISPRCasFinder 1577422-1577455 34 NC_006362 Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence 89410-89443 5 0.853
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NC_010850 Rhodococcus sp. NS1 plasmid pNSL1, complete sequence 92901-92931 5 0.839
NC_009565_1 1.1|369637|27|NC_009565|CRISPRCasFinder 369637-369663 27 NZ_CP045917 Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence 207335-207361 6 0.778
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 435770-435802 6 0.818
NC_009565_1 1.7|370033|27|NC_009565|CRISPRCasFinder 370033-370059 27 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 32942-32968 6 0.778
NC_009565_1 1.9|370183|27|NC_009565|CRISPRCasFinder 370183-370209 27 NC_009959 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence 50750-50776 6 0.778
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 179708-179734 6 0.778
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4846911-4846937 6 0.778
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 78863-78889 6 0.778
NC_009565_1 1.10|370243|27|NC_009565|CRISPRCasFinder 370243-370269 27 MK494099 Mycobacterium phage Typha, complete genome 33831-33857 6 0.778
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1565268-1565297 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 KX620751 Propionibacterium phage Doucette, complete genome 8876-8905 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_041891 Propionibacterium phage B22, complete genome 8817-8846 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_041894 Propionibacterium phage E6, complete genome 8927-8956 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 KX620754 Propionibacterium phage G4, complete genome 8865-8894 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 575683-575712 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1829167-1829196 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 MT818419 Mycobacterium phage Lolalove, complete genome 27446-27475 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 MN428050 Mycobacterium phage Apex, complete genome 27615-27644 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 MN234171 Mycobacterium phage Magpie, complete genome 27275-27304 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 KX589269 Mycobacterium phage Fortunato, complete genome 27431-27460 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_042035 Mycobacterium phage Zemanar, complete sequence 27435-27464 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_022331 Mycobacterium phage Bane1, complete genome 27108-27137 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 KF279413 Mycobacterium phage Bane2, complete genome 27087-27116 6 0.8
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 MT310870 Mycobacterium phage RawrgerThat, complete genome 27434-27463 6 0.8
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 GQ141189 Bifidobacterium phage Bbif-1, complete sequence 38062-38092 6 0.806
NC_009565_5 5.9|929542|27|NC_009565|CRT 929542-929568 27 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 147990-148016 6 0.778
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 508-537 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 280809-280838 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 561652-561681 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554428-554457 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542116-542145 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 610786-610815 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571170-571199 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1563589-1563618 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 421135-421164 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1217050-1217079 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1265979-1266008 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1135414-1135443 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP037868 Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence 5790-5819 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1195134-1195163 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1134511-1134540 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 762260-762289 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1168711-1168740 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1168700-1168729 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1135406-1135435 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1134762-1134791 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1135397-1135426 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1217165-1217194 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1217149-1217178 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1217142-1217171 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_019408 Caulobacter phage CcrRogue, complete genome 180466-180495 6 0.8
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 174181-174210 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP017941 Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence 270228-270257 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 MK937608 Microbacterium phage Cressida, complete genome 54022-54051 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 554437-554466 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 542125-542154 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP017592 Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence 7337-7366 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP008898 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence 43955-43984 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP023489 Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence 73653-73682 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP043515 Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence 36331-36360 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 571179-571208 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_LT984809 Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence 317155-317184 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP026371 Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence 116386-116415 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP050069 Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence 79588-79617 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP039425 Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence 132572-132601 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP009856 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence 26128-26157 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP039430 Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence 132570-132599 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP040937 Hymenobacter sp. DG01 plasmid unnamed, complete sequence 32030-32059 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 14031-14060 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 17715-17744 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP006588 Hymenobacter sp. APR13 plasmid pHA, complete sequence 19031-19060 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1930897-1930926 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 190353-190382 6 0.8
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 MH029534 Myoviridae environmental samples clone NHS-Seq2, complete sequence 34123-34152 6 0.8
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 MT723940 Mycobacterium phage Ellie, complete genome 24126-24161 6 0.833
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 39276-39303 6 0.786
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NC_008703 Mycobacterium sp. KMS plasmid pMKMS01, complete sequence 76834-76861 6 0.786
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NZ_LR594663 Variovorax sp. RA8 plasmid 2 131793-131820 6 0.786
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_LR594669 Variovorax sp. SRS16 plasmid 4 27764-27794 6 0.806
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_LR594673 Variovorax sp. PBL-E5 plasmid 3 438646-438676 6 0.806
NC_009565_7 7.13|1577422|34|NC_009565|CRISPRCasFinder 1577422-1577455 34 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 28989-29022 6 0.824
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NC_009478 Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence 8328-8358 6 0.806
NC_009565_1 1.4|369832|27|NC_009565|CRISPRCasFinder 369832-369858 27 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 48081-48107 7 0.741
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2600082-2600111 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 2593965-2593994 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 LR134127 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7 110413-110442 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 444400-444429 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP012477 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence 741115-741144 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP012478 Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence 144936-144965 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 444383-444412 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 66483-66512 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 320484-320513 7 0.767
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 26400-26429 7 0.767
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MK977708 Mycobacterium phage Fulbright, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MG099948 Mycobacterium phage Philonius, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MH926055 Mycobacterium phage Chewbacca, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MT723932 Mycobacterium phage Schnauzer, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 KU935726 Mycobacterium phage Xerxes, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 KU935730 Mycobacterium phage Pipsqueaks, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MH316570 Mycobacterium phage Silvafighter, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MK524518 Mycobacterium phage Smurph, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MK524515 Mycobacterium phage Parmesanjohn, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MH697585 Mycobacterium phage Gex, complete genome 10280-10310 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 KM588359 Mycobacterium phage Carcharodon, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MH697576 Mycobacterium phage Aggie, complete genome 10282-10312 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MH697593 Mycobacterium phage Tapioca, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 MG099936 Mycobacterium phage Andies, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 NC_031243 Mycobacterium phage Xeno, complete genome 10281-10311 7 0.774
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 JN256079 Mycobacterium phage Charlie, complete genome 10281-10311 7 0.774
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 943873-943902 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 392100-392129 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 1838430-1838459 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 616186-616215 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 397449-397478 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1703655-1703684 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 212329-212358 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 679499-679528 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 1744018-1744047 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1760732-1760761 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 178925-178954 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 75369-75398 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 153012-153041 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 589998-590027 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP010410 Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence 81538-81567 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 845884-845913 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 258296-258325 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 1723933-1723962 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1859622-1859651 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1841724-1841753 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 137321-137350 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 258496-258525 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 257917-257946 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 234345-234374 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 461507-461536 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 254201-254230 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 236985-237014 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 298368-298397 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 258487-258516 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 461579-461608 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 390422-390451 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1964821-1964850 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 461516-461545 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 237930-237959 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 849014-849043 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1227007-1227036 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 238244-238273 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 245279-245308 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 235437-235466 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 126762-126791 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 234570-234599 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 258309-258338 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 231309-231338 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 235690-235719 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 238261-238290 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 251052-251081 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 298440-298469 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 230351-230380 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 461938-461967 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 438995-439024 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 245262-245291 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 245236-245265 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 241864-241893 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 240004-240033 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 235466-235495 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 252665-252694 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 280525-280554 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 251050-251079 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 230352-230381 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 236955-236984 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 251053-251082 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 HM560026 Uncultured bacterium plasmid pTRACA45, complete sequence 1764-1793 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_010867 Neisseria lactamica plasmid pNL3.1, complete sequence 3216-3245 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP020471 Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence 121720-121749 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 535160-535189 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 326858-326887 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP035710 Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence 121664-121693 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 KT997827 Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome 28429-28458 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 235977-236006 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_020062 Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence 1424992-1425021 7 0.767
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 KT997829 Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome 24686-24715 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013634 Rhizobium sp. N324 plasmid pRspN324d, complete sequence 278785-278814 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 113824-113853 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 158849-158878 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_007765 Rhizobium etli CFN 42 plasmid p42e, complete sequence 384914-384943 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP006989 Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence 317121-317150 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP020909 Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence 385410-385439 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP024423 Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence 260932-260961 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP020951 Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence 329309-329338 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_021908 Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence 391416-391445 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP020441 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence 243975-244004 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 CP007642 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence 301676-301705 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 201076-201105 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 635292-635321 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 422833-422862 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 LN997843 Streptomyces reticuli genome assembly TUE45, plasmid : II 494408-494437 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 MN582086 Siphoviridae sp. ctdEk19, complete genome 33318-33347 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 864583-864612 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP022700 Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence 61493-61522 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 1238691-1238720 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1484042-1484071 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1466967-1466996 7 0.767
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 119508-119537 7 0.767
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 NC_022087 Mycobacterium phage AnnaL29, complete genome 5558-5593 7 0.806
NC_009565_7 7.1|1576558|28|NC_009565|CRISPRCasFinder 1576558-1576585 28 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 259627-259654 7 0.75
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP041045 Paracoccus sp. AK26 plasmid pAK1, complete sequence 281800-281830 7 0.774
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 CP017041 Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence 68407-68437 7 0.774
NC_009565_8 8.3|2096605|30|NC_009565|CRT 2096605-2096634 30 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 52187-52216 7 0.767
NC_009565_8 8.3|2096605|30|NC_009565|CRT 2096605-2096634 30 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 75140-75169 7 0.767
NC_009565_8 8.3|2096605|30|NC_009565|CRT 2096605-2096634 30 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 376489-376518 7 0.767
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP010990 Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence 147567-147597 7 0.774
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP012186 Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence 36995-37025 7 0.774
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP042263 Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence 372247-372277 7 0.774
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1386736-1386768 8 0.758
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NC_016624 Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence 35126-35158 8 0.758
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1241611-1241643 8 0.758
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 275839-275871 8 0.758
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP029834 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence 310597-310629 8 0.758
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP045074 Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence 437642-437671 8 0.733
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP015269 Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence 9052-9081 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2714450-2714479 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 837910-837939 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 424702-424731 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 975216-975245 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1013021-1013050 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_KY126370 Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence 93253-93282 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP054625 Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence 22400-22429 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1889334-1889363 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_LT960615 Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence 21202-21231 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP046347 Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence 30108-30137 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP044100 Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence 32856-32885 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP032156 Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence 111116-111145 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 KY555144 Caulobacter phage Ccr5, complete genome 178242-178271 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_KP873172 Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence 21059-21088 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 159096-159125 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NC_021492 Enterobacter sp. R4-368 plasmid pENT01, complete sequence 50097-50126 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP022156 Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence 15249-15278 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP024682 Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence 41943-41972 8 0.733
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 242723-242752 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 28649-28678 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP020899 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence 310870-310899 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP022369 Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence 462801-462830 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013525 Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence 292109-292138 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013588 Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence 287383-287412 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013577 Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence 292305-292334 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013549 Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence 292675-292704 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013529 Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence 306458-306487 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013534 Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence 292675-292704 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013539 Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence 295900-295929 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013545 Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence 292670-292699 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013582 Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence 306458-306487 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP013571 Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence 292305-292334 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_010998 Rhizobium etli CIAT 652 plasmid pA, complete sequence 298287-298316 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1682210-1682239 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 294530-294559 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_LR134452 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence 375826-375855 8 0.733
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_AP014706 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence 112972-113001 8 0.733
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 MG770216 Mycobacterium phage Rem711, complete genome 26292-26327 8 0.778
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 KY087993 Mycobacterium phage Hammy, complete genome 24359-24394 8 0.778
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 MF140406 Mycobacterium phage DarthP, complete genome 24368-24403 8 0.778
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP017076 Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence 349053-349083 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP039899 Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence 336247-336277 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP039913 Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence 262996-263026 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP039890 Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence 336247-336277 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP018001 Rhizobium sp. Y9 plasmid pY9, complete sequence 264529-264559 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_022536 Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence 458177-458207 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 311056-311086 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP018075 Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence 88587-88617 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 CP036360 Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence 284157-284187 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 300067-300097 8 0.742
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 1510497-1510527 8 0.742
NC_009565_8 8.3|2096605|30|NC_009565|CRT 2096605-2096634 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 9194-9223 8 0.733
NC_009565_8 8.3|2096605|30|NC_009565|CRT 2096605-2096634 30 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 983284-983313 8 0.733
NC_009565_11 11.6|3134261|29|NC_009565|PILER-CR 3134261-3134289 29 MK599315 Pseudomonas phage PA1C, complete genome 299172-299200 8 0.724
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 CP033373 Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence 12237-12267 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP026091 Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence 1260343-1260373 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP021653 Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence 1009358-1009388 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 1260501-1260531 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP021767 Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence 1009351-1009381 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP012940 Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence 756669-756699 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP012944 Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence 1137767-1137797 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP012688 Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence 1009365-1009395 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NC_017575 Ralstonia solanacearum Po82 megaplasmid, complete sequence 1260057-1260087 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP026308 Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence 1260001-1260031 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 981946-981976 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 CP047139 Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence 938267-938297 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP051295 Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence 748414-748444 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 CP047137 Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence 896022-896052 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NZ_CP027299 Streptomyces sp. SGAir0924 plasmid unnamed_5 215713-215743 8 0.742
NC_009565_12 12.7|3753560|31|NC_009565|CRT 3753560-3753590 31 NC_014213 Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence 111748-111778 8 0.742
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 91175-91207 9 0.727
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 668963-668995 9 0.727
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 789706-789738 9 0.727
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 625853-625885 9 0.727
NC_009565_2 2.2|634564|30|NC_009565|CRT 634564-634593 30 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 1695112-1695141 9 0.7
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 NZ_CP014964 Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence 13698-13728 9 0.71
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 NC_015974 Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence 20960-20990 9 0.71
NC_009565_3 3.1|695276|31|NC_009565|CRISPRCasFinder 695276-695306 31 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 15390-15420 9 0.71
NC_009565_5 5.12|929683|30|NC_009565|CRT 929683-929712 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5046041-5046070 9 0.7
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NC_005241 Cupriavidus necator H16 megaplasmid pHG1, complete sequence 65937-65966 9 0.7
NC_009565_5 5.14|929779|30|NC_009565|CRT 929779-929808 30 NZ_CP039289 Cupriavidus necator H16 plasmid pHG1, complete sequence 65937-65966 9 0.7
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 MF140398 Mycobacterium phage Amohnition, complete genome 24446-24481 9 0.75
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 345043-345073 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 245050-245080 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_022049 Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence 194387-194417 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 MN234199 Mycobacterium phage Ekdilam, complete genome 24235-24265 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP023000 Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence 1145162-1145192 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP015737 Shinella sp. HZN7 plasmid pShin-01, complete sequence 453136-453166 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP013740 Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence 2806-2836 9 0.71
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1908459-1908489 9 0.71
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 922290-922323 9 0.735
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 MG812496 Gordonia phage SallySpecial, complete genome 7675-7708 9 0.735
NC_009565_12 12.9|3753692|37|NC_009565|CRT 3753692-3753728 37 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 975062-975098 9 0.757
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 91179-91211 10 0.697
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 90245-90277 10 0.697
NC_009565_1 1.6|369967|33|NC_009565|CRISPRCasFinder 369967-369999 33 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 99166-99198 10 0.697
NC_009565_5 5.2|929224|39|NC_009565|CRT 929224-929262 39 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 107058-107096 10 0.744
NC_009565_5 5.5|929377|36|NC_009565|CRT 929377-929412 36 KX683875 Mycobacterium phage Baehexic, complete genome 12172-12207 10 0.722
NC_009565_5 5.5|929377|36|NC_009565|CRT 929377-929412 36 KM197169 Mycobacterium phage Piro94, complete genome 12169-12204 10 0.722
NC_009565_5 5.5|929377|36|NC_009565|CRT 929377-929412 36 MF668269 Mycobacterium phage Drake55, complete genome 12168-12203 10 0.722
NC_009565_5 5.5|929377|36|NC_009565|CRT 929377-929412 36 MK284522 Mycobacterium phage Malec, complete genome 11941-11976 10 0.722
NC_009565_5 5.5|929377|36|NC_009565|CRT 929377-929412 36 KM677210 Mycobacterium phage Larenn, complete genome 11936-11971 10 0.722
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 MN369764 Mycobacterium phage Rahalelujah, complete genome 24340-24375 10 0.722
NC_009565_5 5.16|929869|36|NC_009565|CRT 929869-929904 36 NZ_CP025548 Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence 25147-25182 10 0.722
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_017273 Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence 425898-425928 10 0.677
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 344090-344120 10 0.677
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_008269 Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence 68383-68413 10 0.677
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NC_017590 Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence 16322-16352 10 0.677
NC_009565_7 7.10|1577173|31|NC_009565|CRISPRCasFinder 1577173-1577203 31 NZ_AP014581 Burkholderia sp. RPE67 plasmid p3, complete sequence 131907-131937 10 0.677
NC_009565_7 7.13|1577422|34|NC_009565|CRISPRCasFinder 1577422-1577455 34 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 1081518-1081551 10 0.706
NC_009565_10 10.9|3131768|35|NC_009565|PILER-CR,CRISPRCasFinder,CRT 3131768-3131802 35 NZ_AP022607 Mycobacterium branderi strain JCM 12687 plasmid pJCM12687 414652-414686 10 0.714
NC_009565_11 11.15|3134917|34|NC_009565|PILER-CR 3134917-3134950 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_009565_11 11.28|3134913|34|NC_009565|CRISPRCasFinder,CRT 3134913-3134946 34 NZ_AP022335 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence 171698-171731 10 0.706
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 470079-470112 10 0.706
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NZ_CP024986 Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence 68774-68807 10 0.706
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NC_024970 Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NZ_KJ396772 Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence 172270-172303 10 0.706
NC_009565_12 12.5|3753419|34|NC_009565|CRT 3753419-3753452 34 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 326578-326611 11 0.676
NC_009565_12 12.9|3753692|37|NC_009565|CRT 3753692-3753728 37 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 232224-232260 11 0.703
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP025547 Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence 261165-261211 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 1085507-1085553 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 1151729-1151775 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 634102-634148 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1302030-1302076 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 895526-895572 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1422893-1422939 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 373499-373545 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 794834-794880 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 1085512-1085558 11 0.766
NC_009565_14 14.6|3961962|47|NC_009565|CRT 3961962-3962008 47 NZ_CP005085 Sphingobium sp. TKS plasmid pTK1, complete sequence 306646-306692 12 0.745

1. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

2. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcggcc	Protospacer
********************* 

3. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcgggccggcggca	Protospacer
**********.***********

4. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

5. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

6. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

7. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955

caatccggcggcgccgccggca	CRISPR spacer
caattcggcggcgccgccggca	Protospacer
****.*****************

8. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

9. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

10. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

11. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

12. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909

gttgccgattaggacggcggcc	CRISPR spacer
cttgccgatcaggacggcggcc	Protospacer
 ********.************

13. spacer 7.3|1576672|22|NC_009565|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909

ggtaccgtcctcgccggcggtg	CRISPR spacer
ggcaccgtcctcgccggcggtt	Protospacer
**.****************** 

14. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

15. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

16. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

17. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcc	Protospacer
.******************** 

18. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

19. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

20. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

21. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

22. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
atcgccgatcaggccggcggcg	Protospacer
.********************.

23. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgggg	Protospacer
******************** .

24. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
accgccgatcaggccggcggca	Protospacer
..********************

25. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ctcggcgatcaggccggcggca	Protospacer
 *** *****************

26. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

27. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

28. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

29. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

30. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcg	Protospacer
***************** ***.

31. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
ggcgccgatcaggccggcggcc	Protospacer
* ******************* 

32. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggcctgcggcg	Protospacer
*************** *****.

33. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatccggccggcggct	Protospacer
********** ********** 

34. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgccg	Protospacer
******************* *.

35. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgagcaggccggcggcc	Protospacer
******** ************ 

36. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccgggggcc	Protospacer
***************** *** 

37. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

38. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

39. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacccgccgaacccgtcg	Protospacer
********** ******* ******

40. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgacctcggcggcgcgggcga	Protospacer
.***************** ****.

41. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctgggcggcgctggcgg	Protospacer
 ****.*** **************

42. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

43. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
agccgacctcggcggcgatggcgc	Protospacer
*.*************** ***** 

44. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

45. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
taacgtcctcggcggcgctggcgg	Protospacer
 * ** ******************

46. spacer 5.15|929827|24|NC_009565|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

47. spacer 5.15|929827|24|NC_009565|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

48. spacer 5.15|929827|24|NC_009565|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

49. spacer 5.15|929827|24|NC_009565|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

50. spacer 5.15|929827|24|NC_009565|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
gaccgcgctcggcggcgctggcgg	Protospacer
.****  *****************

51. spacer 5.15|929827|24|NC_009565|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
catcggcctcggcggcgctggcgg	Protospacer
 *.**.******************

52. spacer 5.15|929827|24|NC_009565|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aaccggcctcggcggcgctgccgc	Protospacer
*****.************** ** 

53. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccgagctcggcggcgctgccgg	Protospacer
 ***** ************* ***

54. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
caccggcctcggcggcgcgggcgg	Protospacer
 ****.************ *****

55. spacer 5.15|929827|24|NC_009565|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875

aaccgacctcggcggcgctggcgg	CRISPR spacer
aacccacctcggcggcgatggcgc	Protospacer
**** ************ ***** 

56. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
gtcgccgatcaggccggcgcgg	Protospacer
*******************  .

57. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864

gtcgccgatcaggccggcggca	CRISPR spacer
ttcgccgatcaggccggcggtg	Protospacer
 *******************..

58. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
ctcgccgaacacgcggaagccgtct	Protospacer
**.*********** ********* 

59. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
attgtcgaacacgcggaagccgtcg	Protospacer
 ***.********* **********

60. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

61. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

62. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaactcgccgaagccgttg	Protospacer
 ********* ************.*

63. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
catgcggaacacgccgaatccgtcg	Protospacer
* *** ************ ******

64. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgatcacgccgtagccgttg	Protospacer
******** ******* ******.*

65. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864

caatccggcggcgccgccggca	CRISPR spacer
gaatccggcggcgccgccgggc	Protospacer
 *******************  

66. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

67. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875

atcgaagaagctgaacccgccgtt	CRISPR spacer
cgcgaagaagctgaagccgccgtt	Protospacer
  ************* ********

68. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

69. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852

-aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg	Protospacer
 *..** ********* ***********

70. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ccgaagccgatgtcgtagcggccggcg	Protospacer
 ************.***** *****.*

71. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg	Protospacer
.* ********* ***********.**

72. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852

accccgccgaagttgaggtcgccgagg	CRISPR spacer
acggcgccgaagttgaggccgccgacg	Protospacer
**  **************.****** *

73. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867

accacgccggtgaccacgccg-ccaacgacg	CRISPR spacer
accacgccggtggccacgccgaccagcggc-	Protospacer
************.******** ***.**.* 

74. spacer 4.1|788366|24|NC_009565|PILER-CR matches to MK686069 (Streptomyces phage Heather, complete genome) position: , mismatch: 4, identity: 0.833

gagcgcaagctcacgagtgaggag	CRISPR spacer
acgcgcaagctcacgagtcaggac	Protospacer
. **************** **** 

75. spacer 5.9|929542|27|NC_009565|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgcatccggcggcggcggttgcgttct	Protospacer
** **************** ***** .

76. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggcctcggcggcggcggtggcgttgc	Protospacer
*** ..*************.*******

77. spacer 5.9|929542|27|NC_009565|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggccgcggcggcggcggtagcggtgc	Protospacer
*** . ***************** ***

78. spacer 5.14|929779|30|NC_009565|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc	Protospacer
 ************ ********* ***.** 

79. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

80. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
gcccgatctcggcggcgctggcgt	Protospacer
. ****.**************** 

81. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

82. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgtcgacgtcggcggcgctggcgg	Protospacer
 ..**** ****************

83. spacer 5.15|929827|24|NC_009565|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cttcgacttcggcggcgctggcgg	Protospacer
  .****.****************

84. spacer 5.15|929827|24|NC_009565|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

85. spacer 5.15|929827|24|NC_009565|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

86. spacer 5.15|929827|24|NC_009565|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

87. spacer 5.15|929827|24|NC_009565|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ccgcggcctcggcggcgctggcgg	Protospacer
   **.******************

88. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
cgccgacctcggcggcggtggcga	Protospacer
 .*************** *****.

89. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tcccgacctcggcggtgctggcgc	Protospacer
  *************.******* 

90. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ctacgaccacggcggcgctggcgg	Protospacer
   ***** ***************

91. spacer 5.15|929827|24|NC_009565|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tctcgacctcggcggcgatggcgg	Protospacer
  .************** ******

92. spacer 5.15|929827|24|NC_009565|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
tgccgacctcggctgcgctggcgc	Protospacer
 .*********** ********* 

93. spacer 5.15|929827|24|NC_009565|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833

aaccgacctcggcggcgctggcgg	CRISPR spacer
ggtcgacctcgacggcgctggcgg	Protospacer
...********.************

94. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

95. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

96. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gccgccgggggtgccctcgttgccgggc	Protospacer
*..************ ********** *

97. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
tccgccgaacgcgccgaagccgtcg	Protospacer
...*******.**************

98. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

99. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gctgccgaacacgccgatgccgacg	Protospacer
 .*************** **** **

100. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

101. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

102. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gatgctgatcacgccgaagccgtcg	Protospacer
  ***.** ****************

103. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cttgccgaacacgccgatgccctgc	Protospacer
***************** *** *  

104. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
aatgccgaattcgccgaagccgtcg	Protospacer
  *******. **************

105. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84

cttgccgaacacgccgaagccgtcg	CRISPR spacer
cccgtagaacacgccgaagccgtcg	Protospacer
*..*. *******************

106. spacer 7.14|1577488|25|NC_009565|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84

cttgccgccaccgacccccccttgc	CRISPR spacer
ttttccgacaccgacccccccttga	Protospacer
.** *** **************** 

107. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcgaagaagctgaacacgcccgc	Protospacer
**************** ****  .

108. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
gtcgatgaagctgaacccgccgaa	Protospacer
.**** ****************  

109. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833

atcgaagaagctgaacccgccgtt	CRISPR spacer
atcggagaagctgaacccgcccgg	Protospacer
****.****************   

110. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

111. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
aacgcaccgttgtccacatcaccaatc	Protospacer
********* **********.** .* 

112. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
gcgaagccgaagttgtagctgcgctcg	Protospacer
********** ***********   .*

113. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
atgaagccgatgttgtcgctaccgggg	Protospacer
..************** ***.**** *

114. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

115. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

116. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

117. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccccgcggaagttgaggtcgcgggtg	Protospacer
 ****** ************** *. *

118. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

119. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

120. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

121. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

122. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

123. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

124. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

125. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

126. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

127. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

128. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

129. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
gcgccgccgatgttgagggcgccgagt	Protospacer
.* ******* ******* ******* 

130. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

131. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcaccgccgaagttgaagtggccgagc	Protospacer
 * *************.** ****** 

132. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

133. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

134. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

135. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

136. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

137. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tccttaccgaagttgaggtcgacgagg	Protospacer
 **...*************** *****

138. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

139. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

140. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

141. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

142. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

143. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tcgacgccgaagttgatgtcgacgagg	Protospacer
 *  ************ **** *****

144. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

145. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
ggcaggcggcggcggcggtagcgttgg	Protospacer
 * *  ******************** 

146. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

147. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
aggatccggccgcggcggtagcgctcg	Protospacer
 ********* ************.*  

148. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgggtccggcggcggcggtggcggttt	Protospacer
***.***************.*** * .

149. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgactccggcggcgggggtagcgttcg	Protospacer
**. *********** *********  

150. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cgccgccggcggcggcggtggcgttgg	Protospacer
**   **************.****** 

151. spacer 5.9|929542|27|NC_009565|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

152. spacer 5.9|929542|27|NC_009565|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815

cggatccggcggcggcggtagcgttgc	CRISPR spacer
tgactccggcggcggccgtggcgttgc	Protospacer
.*. ************ **.*******

153. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgaggccggcctgctggtcgtctccgggct	Protospacer
*** **************** ******   

154. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agattccggcctgttcgtcggctccggcgg	Protospacer
 **. ********.* **************

155. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg	Protospacer
** *..********** ***** *******

156. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg	Protospacer
** ******************* * *  **

157. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
cgacgccggcatgccggtcggcttcctgct-	Protospacer
********** ***.******* *** **  

158. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

159. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc	Protospacer
 .************ ********* **** 

160. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg	Protospacer
*******.***** **********   ***

161. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833

cctgctg--ttcggctccggcggcgctggcgg	CRISPR spacer
--tactgattacggctccggcggtgctggcgg	Protospacer
  *.***  * ************.********

162. spacer 5.14|929779|30|NC_009565|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833

--cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg	Protospacer
  ***.*  *************** *.*****

163. spacer 5.15|929827|24|NC_009565|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792

aaccgacctcggcggcgctggcgg	CRISPR spacer
gggcgacctcggcggcgctggcct	Protospacer
.. *******************  

164. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gctgccgtgggtgccatcgttgccgagt	Protospacer
*.***** *****************. .

165. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

166. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc	Protospacer
*.  ***********.********* **

167. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
gttgccgcgggtgccctcgttgcggacg	Protospacer
******* ******* ******* *.* 

168. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gccgccgaacacgccgaagccgttt	Protospacer
 ..********************. 

169. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8

cttgccgaacacgccgaagccgtcg	CRISPR spacer
gttgccgaacacgccgacgccgcgc	Protospacer
 **************** ****.  

170. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

171. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

172. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839

aattg--cgccttgcccgccgttgccgccggca	CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca	Protospacer
  ***  *.****** **** ************

173. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853

gtcgccgtgcagccagccaccaccgcca-ccggcg	CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc-	Protospacer
 *************.********* *** ** ** 

174. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839

aacgccc-acttcaccgccgttgccgccgtca	CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga	Protospacer
 **.*** ************.********  *

175. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778

aacgcaccggtgtccacatcgcccgtg	CRISPR spacer
agttcactggtgtccacatcgcccgaa	Protospacer
*.. ***.***************** .

176. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg	Protospacer
**   *.***** ******************.*

177. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778

gcgaagccgatgttgtagctgccggtg	CRISPR spacer
ggataggcgatgttgtagctgccggaa	Protospacer
* . ** ****************** .

178. spacer 1.9|370183|27|NC_009565|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778

gccaagccgatatcgaagatcccggtg	CRISPR spacer
accatgccgatatcgacgatcccgtcc	Protospacer
.*** *********** ******* . 

179. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
tagacgccgaagtcgaggtcggcgagg	Protospacer
    *********.******* *****

180. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
ctcccgccgaagttgagggtgccgaac	Protospacer
 .**************** .*****. 

181. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
aagaagccgaagttgaggtcgccgtag	Protospacer
*    ******************* .*

182. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778

accccgccgaagttgaggtcgccgagg	CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg	Protospacer
   .******.**.*************

183. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gcgccgccggtgactacgccgccagcgaca	Protospacer
.*  **********.*********.****.

184. spacer 2.2|634564|30|NC_009565|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

185. spacer 2.2|634564|30|NC_009565|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

186. spacer 2.2|634564|30|NC_009565|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

187. spacer 2.2|634564|30|NC_009565|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gagactccggtgaccacgccgccatcgatg	Protospacer
.  ** ****************** ***.*

188. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tccacgccggtgaccacgccgaccaccttg	Protospacer
 ******************** * **  .*

189. spacer 2.2|634564|30|NC_009565|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
aagaggccggcgagcacgccgccaacgaag	Protospacer
*  * *****.** ************** *

190. spacer 2.2|634564|30|NC_009565|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

191. spacer 2.2|634564|30|NC_009565|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

192. spacer 2.2|634564|30|NC_009565|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

193. spacer 2.2|634564|30|NC_009565|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

194. spacer 2.2|634564|30|NC_009565|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

195. spacer 2.2|634564|30|NC_009565|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

196. spacer 2.2|634564|30|NC_009565|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

197. spacer 2.2|634564|30|NC_009565|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg	Protospacer
*.*. * ****************. *****

198. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806

agcgcgaacggcaagccgaac----cgttggaccc	CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg----	Protospacer
************ ********    **.***    

199. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778

cggatccggcggcggcggtagcgttgc	CRISPR spacer
cggatcctgcggcggcggtagaaagcc	Protospacer
******* ************* .   *

200. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

201. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc	Protospacer
 ..**.*****************.***** 

202. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctggtggtcggctacctcga	Protospacer
***** ******* ********* *  **.

203. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

204. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

205. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

206. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg	Protospacer
**  ..********** ***** *******

207. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg	Protospacer
**    **** ***.***************

208. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac	Protospacer
**  ** ****************.****. 

209. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

210. spacer 5.12|929683|30|NC_009565|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

211. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

212. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcg----gctccggcgg	CRISPR spacer
cgacgccggccggctggtcggagagctgcg----	Protospacer
*********** ********    *** **    

213. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

214. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

215. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg	Protospacer
** *************.******.*  * *

216. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

217. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

218. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

219. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

220. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

221. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

222. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

223. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggtcctggcctgctggtcggcgccggcag	Protospacer
**.. *.*************** *****.*

224. spacer 5.12|929683|30|NC_009565|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc	Protospacer
** *..************** * ****** 

225. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccgacctgctggtcggggcggactg	Protospacer
********.************  * *.* *

226. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
caagctggtcggccccggcggcgctggcaa	Protospacer
*  **** *****.**************..

227. spacer 5.14|929779|30|NC_009565|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tcacctgtccggctccggcggcggtggcga	Protospacer
.*  ****.************** *****.

228. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

229. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

230. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg--	CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg	Protospacer
.************* ********  .**.*  

231. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

232. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

233. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

234. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg	Protospacer
*******.***** **********   .**

235. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg	Protospacer
* *  .*.******.***************

236. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

237. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

238. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

239. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgttcggcgccgccggcgctattgg	Protospacer
 ************ *** *******. .**

240. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgttcggcaccgacggcgccctccg	Protospacer
************* ***.******.  * *

241. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

242. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

243. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt	Protospacer
* * * *.***** *************** 

244. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgt-tcggctccggcggcgctggcgg	CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg	Protospacer
 *.**.*. .********** **********

245. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt--cggctccggcggcgctggcgg	CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg	Protospacer
  .**.*.*  **** ****************

246. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8

cctgctgtt----cggctccggcggcgctggcgg	CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg	Protospacer
    * ***    *************** *****

247. spacer 5.14|929779|30|NC_009565|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8

-cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg	Protospacer
 ..** * ****** *.**************

248. spacer 5.16|929869|36|NC_009565|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg	Protospacer
  * .************************ .*****

249. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

250. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg	Protospacer
* *********** **.********   

251. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
ggtgccggcggtgccatcggtgccgagg	Protospacer
* ****** ********** *****.  

252. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

253. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc	Protospacer
  *****************.****** **  

254. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824

--gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca	Protospacer
  ****.*  *****  ******************.

255. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg	Protospacer
. ** ***************.******* *.

256. spacer 1.4|369832|27|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741

aagccgcccgagttcgcgagaccgaag	CRISPR spacer
tgaccgcccgagttcgcgagacgttgg	Protospacer
 ..*******************   .*

257. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
taggcgccggtgaccccgccgccgacgatg	Protospacer
   .*********** *******.****.*

258. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg	Protospacer
  *..* ******************.*.**

259. spacer 2.2|634564|30|NC_009565|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
atagcgccggtcaccgcgccgccaacgata	Protospacer
*. .******* ***.************..

260. spacer 2.2|634564|30|NC_009565|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

261. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

262. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
accacgccggtgacctcaccgcccgctgtg	Protospacer
*************** *.***** .* ..*

263. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg	Protospacer
*** **.****************.   * *

264. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag	Protospacer
 * .***********.********* *  *

265. spacer 2.2|634564|30|NC_009565|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggcccgccgatggccacgccgccaacggca	Protospacer
. * *****.**.**************.*.

266. spacer 2.2|634564|30|NC_009565|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg	Protospacer
..*. * ****************. *****

267. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

268. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

269. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

270. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

271. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

272. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

273. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

274. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

275. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

276. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

277. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

278. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

279. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

280. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

281. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

282. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg	Protospacer
 ************  ***********. *  

283. spacer 5.12|929683|30|NC_009565|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc	Protospacer
 * ****************** *.***   

284. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

285. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

286. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

287. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

288. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

289. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc	Protospacer
* .*  *.***********.********* 

290. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

291. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

292. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

293. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

294. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

295. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

296. spacer 5.12|929683|30|NC_009565|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggaccggcccgctggtcggccccggctt	Protospacer
**. .******.**********.*****  

297. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gctgggcggcctgctggtcggctggggcgg	Protospacer
    * *****************  *****

298. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

299. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

300. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

301. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

302. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

303. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

304. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt	Protospacer
 ************* ********.*. *  

305. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

306. spacer 5.12|929683|30|NC_009565|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

307. spacer 5.12|929683|30|NC_009565|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

308. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

309. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

310. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

311. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

312. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

313. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

314. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

315. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

316. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

317. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

318. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

319. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

320. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

321. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

322. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

323. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

324. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

325. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

326. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

327. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

328. spacer 5.12|929683|30|NC_009565|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

329. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

330. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

331. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

332. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

333. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

334. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

335. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

336. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

337. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

338. spacer 5.12|929683|30|NC_009565|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

339. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

340. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

341. spacer 5.12|929683|30|NC_009565|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

342. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

343. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

344. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

345. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

346. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

347. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

348. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

349. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

350. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

351. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

352. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

353. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

354. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

355. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

356. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

357. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

358. spacer 5.12|929683|30|NC_009565|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

359. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

360. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

361. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

362. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

363. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

364. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

365. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggacgccggcctgctggtcgactgggaaga	Protospacer
 *******************.**  *. *.

366. spacer 5.12|929683|30|NC_009565|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
acacgccgccctgctggtcggcttaggtcg	Protospacer
  ****** **************. **. *

367. spacer 5.12|929683|30|NC_009565|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc	Protospacer
 .****** **************. * ** 

368. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
agacgccggcctgctgttcggcctcgaccc	Protospacer
 *************** *****..**.*  

369. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgggctcggcctgctgctcggcttcggcga	Protospacer
**.  .********** ******.*****.

370. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggc-tccggcgg	CRISPR spacer
gtcggccggcctgctggtcggcgcccggct-	Protospacer
    ****************** .*****  

371. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgacggcctgctggtcgacttcatccc	Protospacer
***** **************.**.*. *  

372. spacer 5.12|929683|30|NC_009565|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

373. spacer 5.12|929683|30|NC_009565|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac	Protospacer
**   **************** *.****. 

374. spacer 5.12|929683|30|NC_009565|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga	Protospacer
.******* *************   * **.

375. spacer 5.12|929683|30|NC_009565|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcgccggcctgctggaccgctccgtggg	Protospacer
   ************** * ******  **

376. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

377. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttcggggtcggctccggcggcgctggcga	Protospacer
..*   * *********************.

378. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg	Protospacer
*..  .*.*************** ******

379. spacer 5.14|929779|30|NC_009565|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

380. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

381. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

382. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

383. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

384. spacer 5.14|929779|30|NC_009565|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

385. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

386. spacer 5.14|929779|30|NC_009565|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tttccggctcggcgccggcggcgctggcga	Protospacer
..* * *.***** ***************.

387. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

388. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

389. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

390. spacer 5.14|929779|30|NC_009565|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg-	CRISPR spacer
actgctgtccggctccggcggca-tgatgtc	Protospacer
 *******.*************. **..*  

391. spacer 5.14|929779|30|NC_009565|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccggccttcgacttcggcggcgctggcgg	Protospacer
 *.* . ****.**.***************

392. spacer 5.14|929779|30|NC_009565|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

393. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gttcctccacggttccggcggcgctggcgg	Protospacer
 .* ** . ***.*****************

394. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

395. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

396. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg	Protospacer
*.  *** ***************** *. *

397. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tctcgggctcggccccggcggcgctggcgc	Protospacer
.**   *.*****.*************** 

398. spacer 5.16|929869|36|NC_009565|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg	Protospacer
  **************** *********. * * **

399. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75

gttgccgggggtgccatcgttgccggcc	CRISPR spacer
agcacccggggtgccgtcgttgccggcg	Protospacer
. ..** ********.*********** 

400. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc	Protospacer
. *  **** *********.********** 

401. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg	Protospacer
**. ***.************ ******. *.

402. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

403. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

404. spacer 8.3|2096605|30|NC_009565|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac	Protospacer
*. *. ************ ********* .

405. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

406. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg	Protospacer
  *.************ ***.******* *.

407. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atccgccatttcaccgccgttgccgacgccg	Protospacer
* *  ***.**************** **.*.

408. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca	Protospacer
  * **.*****.**************** *..

409. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

410. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact	Protospacer
* ********.**********.**** .**.. 

411. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc	Protospacer
 ***************** ** ***.* *  * 

412. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
agctggttgatgccgatctggccgctgccggtc	Protospacer
** . *..*** ************.******* 

413. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cagacctcggtgaccacgccggcaacgatc	Protospacer
   ** .************** ******. 

414. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
ggttggccggtgaccactccgccagcgatg	Protospacer
. .  ************ ******.***.*

415. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgacgccggcctgctggtcgggctgacctc	Protospacer
********************* .. . *  

416. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

417. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

418. spacer 5.12|929683|30|NC_009565|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg	Protospacer
* .*.    ************* *******

419. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc	Protospacer
*  .   *** ****************** 

420. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

421. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct	Protospacer
 * *************  ********    

422. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

423. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
gttcaccgccctgctgatcggctccggcat	Protospacer
   *.*** *******.***********. 

424. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

425. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

426. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt	Protospacer
 . ******************. ***  * 

427. spacer 5.12|929683|30|NC_009565|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc	Protospacer
 *  ..************** * ****** 

428. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

429. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

430. spacer 5.12|929683|30|NC_009565|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

431. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

432. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
catggccggcctgctgctcggcaccgggac	Protospacer
*.  ************ ***** **** . 

433. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cgatgccggcctgctggtcggggttcccag	Protospacer
***.*****************  ..  *.*

434. spacer 5.14|929779|30|NC_009565|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cgaccatctcggctccgacggcgctggcgc	Protospacer
*   *  .*********.*********** 

435. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

436. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gccaccccgcggctccggaggcgctggcgg	Protospacer
 *..*. . ********* ***********

437. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

438. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

439. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

440. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

441. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

442. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

443. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

444. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

445. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

446. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcgccggcggcgctggcga	Protospacer
. *   *.***** ***************.

447. spacer 5.14|929779|30|NC_009565|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
tatcaggctcggcaccggcggcgctggcga	Protospacer
. *   *.***** ***************.

448. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgctgatcggctccggcgccggcttctc	Protospacer
******* ************ ** .  *  

449. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gctgctgtgcggctccggcggcaaccccga	Protospacer
 ******* *************. .  **.

450. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
cctgatgttcgactccggcggcgacgcacc	Protospacer
**** ******.*********** .*    

451. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg	Protospacer
 *  *   .************** ******

452. spacer 5.16|929869|36|NC_009565|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc	Protospacer
..* . ************.******* ******** 

453. spacer 5.16|929869|36|NC_009565|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

454. spacer 5.16|929869|36|NC_009565|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc	Protospacer
** ******** *************** * .*  * 

455. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc	Protospacer
.   ********.******.*********  

456. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

457. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

458. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

459. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

460. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

461. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

462. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc	Protospacer
.   **************** *.***** * 

463. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa	Protospacer
... ****  ******************  *

464. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgc--gccttgcccgccgttgccgccggca	CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg	Protospacer
  ..**  **********  *********** .

465. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
attgccgccctggccgccgttgccgccgatc	Protospacer
* *  ****.** ***************.. 

466. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

467. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733

tcggagaaagccgtcggtttgcacgctgtt	CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc	Protospacer
.** ... **************.******.

468. spacer 11.6|3134261|29|NC_009565|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724

tccgcgaaattcactgcgcgttattcaag	CRISPR spacer
gacgcgaaatacactgcgctttattttca	Protospacer
  ******** ******** *****.  .

469. spacer 12.7|3753560|31|NC_009565|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg	Protospacer
   *********** ********** **. .

470. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

471. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

472. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

473. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

474. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

475. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

476. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

477. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

478. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

479. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct	Protospacer
 .*. *. ***********.********** 

480. spacer 12.7|3753560|31|NC_009565|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

481. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

482. spacer 12.7|3753560|31|NC_009565|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg	Protospacer
. *******.********** *****  * .

483. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca	Protospacer
  ** . .****.*******.**********

484. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742

aacgcccacttcaccgccgttgccgccgtca	CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt	Protospacer
* ************** **** *** * .. 

485. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc	Protospacer
  *.  .******************.*****. 

486. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

487. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

488. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc	Protospacer
 ***************** ** ***.  *  * 

489. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7

accacgccggtgaccacgccgccaacgacg	CRISPR spacer
cccacgccggtcaccacgccgctgcccggc	Protospacer
 ********** **********.. * .  

490. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga	Protospacer
.* .**************** .*****    

491. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

492. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71

agcgcgaacggcaagccgaaccgttggaccc	CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg	Protospacer
 . ********.***********.**.. * 

493. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7

cgacgccggcctgctggtcggctccggcgg	CRISPR spacer
cggcgccggcctgctggtcggactgctcac	Protospacer
**.****************** ..   *. 

494. spacer 5.14|929779|30|NC_009565|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

495. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7

cctgctgttcggctccggcggcgctggcgg	CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt	Protospacer
  .  .************* ***** *** 

496. spacer 5.16|929869|36|NC_009565|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc	Protospacer
** ******** *************** * ..  * 

497. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg	Protospacer
.... ****.***************** .*.

498. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
tggcccgccttgccctccattgccgccggac	Protospacer
 . . ********** **.**********  

499. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
atccttgccttgaccgccgttgccgccgctg	Protospacer
* .. .****** *************** ..

500. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accccagccctgcccgccgttgccgccgctc	Protospacer
* ..  ***.****************** . 

501. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc	Protospacer
. ******** ********* ****   .* 

502. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
accggcaccttgcccgccattgccgccatgt	Protospacer
* . **.***********.********.   

503. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc	Protospacer
 .   *******.******* *******.* 

504. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
agcgtggccttggccgccgttgccggcggtc	Protospacer
*..   ****** ************ ***. 

505. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg	Protospacer
.**    .********.**** ***********.

506. spacer 12.5|3753419|34|NC_009565|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg	Protospacer
*. . *. *****.***** *************.

507. spacer 12.9|3753692|37|NC_009565|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757

cttgccggcggtgccggcgaccgcggtgccgccggcg	CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc	Protospacer
   * ************ **********.***.* * 

508. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

509. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

510. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697

aggctgccgatcccgatctggccgttgccggtg	CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc	Protospacer
  *.  .**** *************.*****. 

511. spacer 5.2|929224|39|NC_009565|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744

cggcgcgggcggggccgtcacgggaaccggcgccaccgg	CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc	Protospacer
*.  * ** ********.**************** *   

512. spacer 5.5|929377|36|NC_009565|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

513. spacer 5.5|929377|36|NC_009565|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

514. spacer 5.5|929377|36|NC_009565|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

515. spacer 5.5|929377|36|NC_009565|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

516. spacer 5.5|929377|36|NC_009565|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722

aggggccggtgggctgttcaacggcggcggggccgg	CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct	Protospacer
    ****************.****** ** * *  

517. spacer 5.16|929869|36|NC_009565|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac	Protospacer
... .  ************************.**. 

518. spacer 5.16|929869|36|NC_009565|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722

gctgatcggcaacggcggtaacggcggggccggcgg	CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc	Protospacer
* . . ************ ******** ****  * 

519. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

520. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg	Protospacer
  .. ****** *******.********  .

521. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggccagaacttccccgctgttgccgccggca	Protospacer
..... . *** *****.*************

522. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc	Protospacer
.. . *****.********** ****** . 

523. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677

aattgcgccttgcccgccgttgccgccggca	CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc	Protospacer
...   ****** ************ ***. 

524. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706

gtcgccgtgcagccagccaccaccgccaccggcg	CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca	Protospacer
 . .. .*******.***************.**.

525. spacer 10.9|3131768|35|NC_009565|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714

acttgcgcgcacaacgcatccgccatccacggggc	CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt	Protospacer
...  **********.***.**********. **.

526. spacer 11.15|3134917|34|NC_009565|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

527. spacer 11.28|3134913|34|NC_009565|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706

tagaaggcgatcactggaagcacggcgcttgcga	CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac	Protospacer
 . ********** ******* ***** . **. 

528. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc	Protospacer
   . *  ***** **************** ** 

529. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

530. spacer 12.5|3753419|34|NC_009565|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

531. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc	Protospacer
*   .* *******.** *************.  

532. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676

gttttctcccgcgacggtgggggtggcgccggca	CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc	Protospacer
  ...*.  **.********.************ 

533. spacer 12.9|3753692|37|NC_009565|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.703

cttgccggcggtgccggcgaccgcggtgccgccggcg	CRISPR spacer
gccgtgcacggcgccggcggccgcggtgccgccgctg	Protospacer
 ..*.  .***.*******.************** .*

534. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcggggccaacttcaa	CRISPR spacer
tcgggcggcaacggcggggccggcggtagcggcggcgcaggcgcctt	Protospacer
 * *******.************************ ** ..* .*  

535. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

536. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

537. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

538. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

539. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

540. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

541. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

542. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

543. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766

accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct---	Protospacer
..*************** *.***************   **.*.*..*   

544. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 12, identity: 0.745

accggcggcagcggcggggccggcggtagcggcggggccaacttcaa	CRISPR spacer
gtcggcggcagcggcggggacggcggcagcggcggcgggctctttgc	Protospacer
..***************** ******.******** *    ***.. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1946033 : 2006321 47 Burkholderia_virus(46.15%) integrase,transposase attL 1944840:1944857|attR 2011067:2011084
DBSCAN-SWA_2 2954505 : 2992777 48 Mycobacterium_phage(30.0%) capsid,tRNA,terminase,integrase,head,protease attL 2983306:2983333|attR 2992930:2992957
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage