1. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
2. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcggcc Protospacer
*********************
3. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP016457 (Sphingobium sp. RAC03 plasmid pBSY17_2, complete sequence) position: , mismatch: 1, identity: 0.955
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcgggccggcggca Protospacer
**********.***********
4. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
5. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
6. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
7. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 1, identity: 0.955
caatccggcggcgccgccggca CRISPR spacer
caattcggcggcgccgccggca Protospacer
****.*****************
8. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
9. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
10. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
11. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
12. spacer 7.2|1576618|22|NC_009565|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 2, identity: 0.909
gttgccgattaggacggcggcc CRISPR spacer
cttgccgatcaggacggcggcc Protospacer
********.************
13. spacer 7.3|1576672|22|NC_009565|CRISPRCasFinder matches to NZ_CP025510 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvD, complete sequence) position: , mismatch: 2, identity: 0.909
ggtaccgtcctcgccggcggtg CRISPR spacer
ggcaccgtcctcgccggcggtt Protospacer
**.******************
14. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021032 (Rhizobium sp. NXC14 plasmid pRspNXC14b, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
15. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
16. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021028 (Rhizobium sp. TAL182 plasmid pRetTAL182d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
17. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcc Protospacer
.********************
18. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013503 (Rhizobium esperanzae strain N561 plasmid pRspN561c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
19. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013509 (Rhizobium sp. N1341 plasmid pRspN1341d, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
20. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013520 (Rhizobium sp. N113 plasmid pRspN113c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
21. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013493 (Rhizobium sp. N6212 plasmid pRspN6212c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
22. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
atcgccgatcaggccggcggcg Protospacer
.********************.
23. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgggg Protospacer
******************** .
24. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP012698 (Microbacterium sp. No. 7 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
accgccgatcaggccggcggca Protospacer
..********************
25. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ctcggcgatcaggccggcggca Protospacer
*** *****************
26. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
27. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
28. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
29. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
30. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcg Protospacer
***************** ***.
31. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
ggcgccgatcaggccggcggcc Protospacer
* *******************
32. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggcctgcggcg Protospacer
*************** *****.
33. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatccggccggcggct Protospacer
********** **********
34. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgccg Protospacer
******************* *.
35. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to CP042595 (Streptomyces albogriseolus strain LBX-2 plasmid pSALBX2, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgagcaggccggcggcc Protospacer
******** ************
36. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.909
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccgggggcc Protospacer
***************** ***
37. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
38. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
39. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 2, identity: 0.92
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacccgccgaacccgtcg Protospacer
********** ******* ******
40. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgacctcggcggcgcgggcga Protospacer
.***************** ****.
41. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctgggcggcgctggcgg Protospacer
****.*** **************
42. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP034768 (Enterobacter sp. N18-03635 plasmid pFRI-6, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
43. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
agccgacctcggcggcgatggcgc Protospacer
*.*************** *****
44. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
45. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_AP019631 (Enterobacter asburiae strain 17Nkhm-UP2 plasmid pEAS17Nkhm-UP2-1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
taacgtcctcggcggcgctggcgg Protospacer
* ** ******************
46. spacer 5.15|929827|24|NC_009565|CRT matches to KU716094 (Mycobacterium phage Eidsmoe, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
47. spacer 5.15|929827|24|NC_009565|CRT matches to MH371122 (Mycobacterium phage Priya, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
48. spacer 5.15|929827|24|NC_009565|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
49. spacer 5.15|929827|24|NC_009565|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
50. spacer 5.15|929827|24|NC_009565|CRT matches to MG872835 (Mycobacterium phage Conquerage, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
gaccgcgctcggcggcgctggcgg Protospacer
.**** *****************
51. spacer 5.15|929827|24|NC_009565|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
catcggcctcggcggcgctggcgg Protospacer
*.**.******************
52. spacer 5.15|929827|24|NC_009565|CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aaccggcctcggcggcgctgccgc Protospacer
*****.************** **
53. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013426 (Burkholderia sp. MSMB0856 plasmid pMSMB0856, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccgagctcggcggcgctgccgg Protospacer
***** ************* ***
54. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
caccggcctcggcggcgcgggcgg Protospacer
****.************ *****
55. spacer 5.15|929827|24|NC_009565|CRT matches to MH271298 (Microbacterium phage Floof, complete genome) position: , mismatch: 3, identity: 0.875
aaccgacctcggcggcgctggcgg CRISPR spacer
aacccacctcggcggcgatggcgc Protospacer
**** ************ *****
56. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
gtcgccgatcaggccggcgcgg Protospacer
******************* .
57. spacer 7.4|1576726|22|NC_009565|CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 3, identity: 0.864
gtcgccgatcaggccggcggca CRISPR spacer
ttcgccgatcaggccggcggtg Protospacer
*******************..
58. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
ctcgccgaacacgcggaagccgtct Protospacer
**.*********** *********
59. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
attgtcgaacacgcggaagccgtcg Protospacer
***.********* **********
60. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MN586053 (Arthrobacter phage BeatusComedenti, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
61. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_031254 (Arthrobacter phage Kitkat, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
62. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_031231 (Arthrobacter phage KellEzio, complete genome) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaactcgccgaagccgttg Protospacer
********* ************.*
63. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
catgcggaacacgccgaatccgtcg Protospacer
* *** ************ ******
64. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.88
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgatcacgccgtagccgttg Protospacer
******** ******* ******.*
65. spacer 7.15|1577545|22|NC_009565|CRISPRCasFinder matches to NC_008270 (Rhodococcus jostii RHA1 plasmid pRHL2, complete sequence) position: , mismatch: 3, identity: 0.864
caatccggcggcgccgccggca CRISPR spacer
gaatccggcggcgccgccgggc Protospacer
*******************
66. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
67. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 3, identity: 0.875
atcgaagaagctgaacccgccgtt CRISPR spacer
cgcgaagaagctgaagccgccgtt Protospacer
************* ********
68. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NC_023591 (Mycobacterium phage Adler, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
69. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to KF981876 (UNVERIFIED: Mycobacterium phage ADLER F1725, complete genome) position: , mismatch: 4, identity: 0.852
-aacgcaccggtgtccacatcgcccgtg CRISPR spacer
cagtgc-ccggtgtccccatcgcccgtg Protospacer
*..** ********* ***********
70. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 4, identity: 0.852
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ccgaagccgatgtcgtagcggccggcg Protospacer
************.***** *****.*
71. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgaaggtgaggtcgccgggg Protospacer
.* ********* ***********.**
72. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NC_016652 (Rhodococcus phage REQ2, complete genome) position: , mismatch: 4, identity: 0.852
accccgccgaagttgaggtcgccgagg CRISPR spacer
acggcgccgaagttgaggccgccgacg Protospacer
** **************.****** *
73. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 4, identity: 0.867
accacgccggtgaccacgccg-ccaacgacg CRISPR spacer
accacgccggtggccacgccgaccagcggc- Protospacer
************.******** ***.**.*
74. spacer 4.1|788366|24|NC_009565|PILER-CR matches to MK686069 (Streptomyces phage Heather, complete genome) position: , mismatch: 4, identity: 0.833
gagcgcaagctcacgagtgaggag CRISPR spacer
acgcgcaagctcacgagtcaggac Protospacer
. **************** ****
75. spacer 5.9|929542|27|NC_009565|CRT matches to KY945355 (Mycobacterium phage Shandong1, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgcatccggcggcggcggttgcgttct Protospacer
** **************** ***** .
76. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP015095 (Pelagibaca abyssi strain JLT2014 plasmid pPABY4, complete sequence) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggcctcggcggcggcggtggcgttgc Protospacer
*** ..*************.*******
77. spacer 5.9|929542|27|NC_009565|CRT matches to NC_041888 (Mycobacterium phage Tortellini, complete genome) position: , mismatch: 4, identity: 0.852
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggccgcggcggcggcggtagcggtgc Protospacer
*** . ***************** ***
78. spacer 5.14|929779|30|NC_009565|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 4, identity: 0.867
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
gctgctgttcggcgccggcggcg-tggtggc Protospacer
************ ********* ***.**
79. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
80. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
gcccgatctcggcggcgctggcgt Protospacer
. ****.****************
81. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
82. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP016822 (Rhodococcus sp. p52 plasmid pDF03, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgtcgacgtcggcggcgctggcgg Protospacer
..**** ****************
83. spacer 5.15|929827|24|NC_009565|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cttcgacttcggcggcgctggcgg Protospacer
.****.****************
84. spacer 5.15|929827|24|NC_009565|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
85. spacer 5.15|929827|24|NC_009565|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
86. spacer 5.15|929827|24|NC_009565|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
87. spacer 5.15|929827|24|NC_009565|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ccgcggcctcggcggcgctggcgg Protospacer
**.******************
88. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
cgccgacctcggcggcggtggcga Protospacer
.*************** *****.
89. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tcccgacctcggcggtgctggcgc Protospacer
*************.*******
90. spacer 5.15|929827|24|NC_009565|CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ctacgaccacggcggcgctggcgg Protospacer
***** ***************
91. spacer 5.15|929827|24|NC_009565|CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tctcgacctcggcggcgatggcgg Protospacer
.************** ******
92. spacer 5.15|929827|24|NC_009565|CRT matches to MN096355 (Mycobacterium phage Purky, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
tgccgacctcggctgcgctggcgc Protospacer
.*********** *********
93. spacer 5.15|929827|24|NC_009565|CRT matches to MK279853 (Gordonia phage Gray, complete genome) position: , mismatch: 4, identity: 0.833
aaccgacctcggcggcgctggcgg CRISPR spacer
ggtcgacctcgacggcgctggcgg Protospacer
...********.************
94. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
95. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
96. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 4, identity: 0.857
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gccgccgggggtgccctcgttgccgggc Protospacer
*..************ ********** *
97. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
tccgccgaacgcgccgaagccgtcg Protospacer
...*******.**************
98. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
99. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gctgccgaacacgccgatgccgacg Protospacer
.*************** **** **
100. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MT553342 (Microbacterium phage Kelcole, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
101. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NC_048068 (Microbacterium phage OneinaGillian, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
102. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MT310894 (Microbacterium phage Tempo, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
gatgctgatcacgccgaagccgtcg Protospacer
***.** ****************
103. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP047175 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cttgccgaacacgccgatgccctgc Protospacer
***************** *** *
104. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
aatgccgaattcgccgaagccgtcg Protospacer
*******. **************
105. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to MN034284 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_25938 sequence) position: , mismatch: 4, identity: 0.84
cttgccgaacacgccgaagccgtcg CRISPR spacer
cccgtagaacacgccgaagccgtcg Protospacer
*..*. *******************
106. spacer 7.14|1577488|25|NC_009565|CRISPRCasFinder matches to MN582064 (Podoviridae sp. ctka020, complete genome) position: , mismatch: 4, identity: 0.84
cttgccgccaccgacccccccttgc CRISPR spacer
ttttccgacaccgacccccccttga Protospacer
.** *** ****************
107. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcgaagaagctgaacacgcccgc Protospacer
**************** **** .
108. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
gtcgatgaagctgaacccgccgaa Protospacer
.**** ****************
109. spacer 8.5|2096695|24|NC_009565|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 4, identity: 0.833
atcgaagaagctgaacccgccgtt CRISPR spacer
atcggagaagctgaacccgcccgg Protospacer
****.****************
110. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to LR794124 (Vibrio phage vB_Vc_SrVc9 genome assembly, chromosome: 1) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
111. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NC_012662 (Vibrio phage VP93, complete genome) position: , mismatch: 5, identity: 0.815
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
aacgcaccgttgtccacatcaccaatc Protospacer
********* **********.** .*
112. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
gcgaagccgaagttgtagctgcgctcg Protospacer
********** *********** .*
113. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to MN693945 (Marine virus AFVG_250M952, complete genome) position: , mismatch: 5, identity: 0.815
gcgaagccgatgttgtagctgccggtg CRISPR spacer
atgaagccgatgttgtcgctaccgggg Protospacer
..************** ***.**** *
114. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
115. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
116. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013554 (Rhizobium phaseoli strain N931 plasmid pRphaN931b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
117. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP015368 (Methylobacterium phyllosphaerae strain CBMB27 plasmid CBMB27-p1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccccgcggaagttgaggtcgcgggtg Protospacer
****** ************** *. *
118. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
119. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
120. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
121. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
122. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
123. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
124. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
125. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
126. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
127. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013565 (Rhizobium phaseoli strain N831 plasmid pRphaN831b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
128. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
129. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
gcgccgccgatgttgagggcgccgagt Protospacer
.* ******* ******* *******
130. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
131. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcaccgccgaagttgaagtggccgagc Protospacer
* *************.** ******
132. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MN586031 (Gordonia phage Gambino, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
133. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KU998236 (Gordonia phage Blueberry, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
134. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MN062704 (Gordonia phage JuJu, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
135. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK501729 (Gordonia phage Walrus, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
136. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NC_031226 (Gordonia phage BaxterFox, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
137. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK967393 (Rhodococcus phage Whack, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tccttaccgaagttgaggtcgacgagg Protospacer
**...*************** *****
138. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MT723935 (Gordonia phage Azula, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
139. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KU963249 (Gordonia phage Yeezy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
140. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MH153808 (Gordonia phage Petra, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
141. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MT639650 (Gordonia phage Ohgeesy, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
142. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
143. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to KX557275 (Gordonia phage CarolAnn, complete genome) position: , mismatch: 5, identity: 0.815
accccgccgaagttgaggtcgccgagg CRISPR spacer
tcgacgccgaagttgatgtcgacgagg Protospacer
* ************ **** *****
144. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
145. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
ggcaggcggcggcggcggtagcgttgg Protospacer
* * ********************
146. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
147. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
aggatccggccgcggcggtagcgctcg Protospacer
********* ************.*
148. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgggtccggcggcggcggtggcggttt Protospacer
***.***************.*** * .
149. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP049908 (Hymenobacter sp. HDW8 plasmid p_unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgactccggcggcgggggtagcgttcg Protospacer
**. *********** *********
150. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_CP049700 (Bradyrhizobium sp. 1S5 strain 323S2 plasmid pB323S2a, complete sequence) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
cgccgccggcggcggcggtggcgttgg Protospacer
** **************.******
151. spacer 5.9|929542|27|NC_009565|CRT matches to MH576962 (Streptomyces phage Satis, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
152. spacer 5.9|929542|27|NC_009565|CRT matches to MK620894 (Streptomyces phage Kradal, complete genome) position: , mismatch: 5, identity: 0.815
cggatccggcggcggcggtagcgttgc CRISPR spacer
tgactccggcggcggccgtggcgttgc Protospacer
.*. ************ **.*******
153. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgaggccggcctgctggtcgtctccgggct Protospacer
*** **************** ******
154. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agattccggcctgttcgtcggctccggcgg Protospacer
**. ********.* **************
155. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccatcggcctgctgctcggcaccggcgg Protospacer
** *..********** ***** *******
156. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgccgccggcctgctggtcggcgcggcggg Protospacer
** ******************* * * **
157. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 5, identity: 0.833
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
cgacgccggcatgccggtcggcttcctgct- Protospacer
********** ***.******* *** **
158. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
159. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
attgctgttcggctgcggcggcgcgggcgc Protospacer
.************ ********* ****
160. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013631 (Rhizobium sp. N324 plasmid pRspN324a, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcactcgg Protospacer
*******.***** ********** ***
161. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP046705 (Nostoc sp. ATCC 53789 plasmid pNsp_b, complete sequence) position: , mismatch: 5, identity: 0.833
cctgctg--ttcggctccggcggcgctggcgg CRISPR spacer
--tactgattacggctccggcggtgctggcgg Protospacer
*.*** * ************.********
162. spacer 5.14|929779|30|NC_009565|CRT matches to AY950802 (Haloarcula phage SH1, complete genome) position: , mismatch: 5, identity: 0.833
--cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ggcctac--ttcggctccggcggctccggcgg Protospacer
***.* *************** *.*****
163. spacer 5.15|929827|24|NC_009565|CRT matches to NC_006911 (Streptomyces sp. F11 plasmid pFP11, complete sequence) position: , mismatch: 5, identity: 0.792
aaccgacctcggcggcgctggcgg CRISPR spacer
gggcgacctcggcggcgctggcct Protospacer
.. *******************
164. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gctgccgtgggtgccatcgttgccgagt Protospacer
*.***** *****************. .
165. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to KU728633 (Mycobacterium phage Bipper, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
166. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to MK977701 (Mycobacterium phage Cracklewink, complete genome) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gcgtccgggggtgccgtcgttgccgtcc Protospacer
*. ***********.********* **
167. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 5, identity: 0.821
gttgccgggggtgccatcgttgccggcc CRISPR spacer
gttgccgcgggtgccctcgttgcggacg Protospacer
******* ******* ******* *.*
168. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gccgccgaacacgccgaagccgttt Protospacer
..********************.
169. spacer 7.5|1576780|25|NC_009565|CRISPRCasFinder matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.8
cttgccgaacacgccgaagccgtcg CRISPR spacer
gttgccgaacacgccgacgccgcgc Protospacer
**************** ****.
170. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_018746 (Pseudomonas putida ND6 plasmid pND6-2, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
171. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN961671 (Pseudomonas aeruginosa strain 201330 plasmid p201330-IMP, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
172. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN961672 (Pseudomonas aeruginosa strain PA15W plasmid pPA15W-NR, complete sequence) position: , mismatch: 5, identity: 0.839
aattg--cgccttgcccgccgttgccgccggca CRISPR spacer
--ttggccaccttgcacgcccttgccgccggca Protospacer
*** *.****** **** ************
173. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 5, identity: 0.853
gtcgccgtgcagccagccaccaccgcca-ccggcg CRISPR spacer
ttcgccgtgcagccggccaccacctccagcctgc- Protospacer
*************.********* *** ** **
174. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_010850 (Rhodococcus sp. NS1 plasmid pNSL1, complete sequence) position: , mismatch: 5, identity: 0.839
aacgccc-acttcaccgccgttgccgccgtca CRISPR spacer
-acacccgacttcaccgccgctgccgccgaga Protospacer
**.*** ************.******** *
175. spacer 1.1|369637|27|NC_009565|CRISPRCasFinder matches to NZ_CP045917 (Pseudomonas aeruginosa strain CF39S plasmid pCF39S, complete sequence) position: , mismatch: 6, identity: 0.778
aacgcaccggtgtccacatcgcccgtg CRISPR spacer
agttcactggtgtccacatcgcccgaa Protospacer
*.. ***.***************** .
176. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.818
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agcaggtcgatcacgatctggccgttgccggcg Protospacer
** *.***** ******************.*
177. spacer 1.7|370033|27|NC_009565|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.778
gcgaagccgatgttgtagctgccggtg CRISPR spacer
ggataggcgatgttgtagctgccggaa Protospacer
* . ** ****************** .
178. spacer 1.9|370183|27|NC_009565|CRISPRCasFinder matches to NC_009959 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI05, complete sequence) position: , mismatch: 6, identity: 0.778
gccaagccgatatcgaagatcccggtg CRISPR spacer
accatgccgatatcgacgatcccgtcc Protospacer
.*** *********** ******* .
179. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
tagacgccgaagtcgaggtcggcgagg Protospacer
*********.******* *****
180. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
ctcccgccgaagttgagggtgccgaac Protospacer
.**************** .*****.
181. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
aagaagccgaagttgaggtcgccgtag Protospacer
* ******************* .*
182. spacer 1.10|370243|27|NC_009565|CRISPRCasFinder matches to MK494099 (Mycobacterium phage Typha, complete genome) position: , mismatch: 6, identity: 0.778
accccgccgaagttgaggtcgccgagg CRISPR spacer
cggtcgccgaggtcgaggtcgccgagg Protospacer
.******.**.*************
183. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gcgccgccggtgactacgccgccagcgaca Protospacer
.* **********.*********.****.
184. spacer 2.2|634564|30|NC_009565|CRT matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
185. spacer 2.2|634564|30|NC_009565|CRT matches to NC_041891 (Propionibacterium phage B22, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
186. spacer 2.2|634564|30|NC_009565|CRT matches to NC_041894 (Propionibacterium phage E6, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
187. spacer 2.2|634564|30|NC_009565|CRT matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gagactccggtgaccacgccgccatcgatg Protospacer
. ** ****************** ***.*
188. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tccacgccggtgaccacgccgaccaccttg Protospacer
******************** * ** .*
189. spacer 2.2|634564|30|NC_009565|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
aagaggccggcgagcacgccgccaacgaag Protospacer
* * *****.** ************** *
190. spacer 2.2|634564|30|NC_009565|CRT matches to MT818419 (Mycobacterium phage Lolalove, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
191. spacer 2.2|634564|30|NC_009565|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
192. spacer 2.2|634564|30|NC_009565|CRT matches to MN234171 (Mycobacterium phage Magpie, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
193. spacer 2.2|634564|30|NC_009565|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
194. spacer 2.2|634564|30|NC_009565|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
195. spacer 2.2|634564|30|NC_009565|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
196. spacer 2.2|634564|30|NC_009565|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
197. spacer 2.2|634564|30|NC_009565|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.8
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atcgaggcggtgaccacgccgccgccgacg Protospacer
*.*. * ****************. *****
198. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to GQ141189 (Bifidobacterium phage Bbif-1, complete sequence) position: , mismatch: 6, identity: 0.806
agcgcgaacggcaagccgaac----cgttggaccc CRISPR spacer
agcgcgaacggccagccgaaccatgcgctgg---- Protospacer
************ ******** **.***
199. spacer 5.9|929542|27|NC_009565|CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.778
cggatccggcggcggcggtagcgttgc CRISPR spacer
cggatcctgcggcggcggtagaaagcc Protospacer
******* ************* . *
200. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
201. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gagcgtcggcctgctggtcggcttcggcgc Protospacer
..**.*****************.*****
202. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctggtggtcggctacctcga Protospacer
***** ******* ********* * **.
203. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
204. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
205. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
206. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgatcggcctgctgctcggcaccggcgg Protospacer
** ..********** ***** *******
207. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcgcgcggcgtgccggtcggctccggcgg Protospacer
** **** ***.***************
208. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgcggcgggcctgctggtcggcttcggcac Protospacer
** ** ****************.****.
209. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
210. spacer 5.12|929683|30|NC_009565|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
211. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
212. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP037868 (Hydrogenophaga pseudoflava strain DSM 1084 plasmid pDSM1084, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcg----gctccggcgg CRISPR spacer
cgacgccggccggctggtcggagagctgcg---- Protospacer
*********** ******** *** **
213. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
214. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
215. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcgccggcctgctgatcggcttcttctg Protospacer
** *************.******.* * *
216. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
217. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
218. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
219. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
220. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
221. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
222. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
223. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggtcctggcctgctggtcggcgccggcag Protospacer
**.. *.*************** *****.*
224. spacer 5.12|929683|30|NC_009565|CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtcatcggcctgctggtcgtcgccggcgc Protospacer
** *..************** * ******
225. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 6, identity: 0.8
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccgacctgctggtcggggcggactg Protospacer
********.************ * *.* *
226. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017941 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
caagctggtcggccccggcggcgctggcaa Protospacer
* **** *****.**************..
227. spacer 5.14|929779|30|NC_009565|CRT matches to MK937608 (Microbacterium phage Cressida, complete genome) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tcacctgtccggctccggcggcggtggcga Protospacer
.* ****.************** *****.
228. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
229. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
230. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017592 (Pantoea stewartii subsp. stewartii DC283 plasmid ppDSJ01, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg-- CRISPR spacer
tctgctgttcggctgcggcggcg--agcagcg Protospacer
.************* ******** .**.*
231. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP008898 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-576, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
232. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP023489 (Klebsiella pneumoniae subsp. pneumoniae strain ST101:960186733 plasmid p19-10_02, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
233. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043515 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
234. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgctcggcaccggcggcgcgcttgg Protospacer
*******.***** ********** .**
235. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_LT984809 (Cupriavidus taiwanensis isolate Cupriavidus taiwanensis STM 8555 plasmid I, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
catcgcgctcggcttcggcggcgctggcgg Protospacer
* * .*.******.***************
236. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP026371 (Klebsiella quasipneumoniae strain A708 plasmid pA708-3, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
237. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP050069 (Klebsiella aerogenes strain 035 plasmid p035_A-VIM-1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
238. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
239. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP009856 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-784, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgttcggcgccgccggcgctattgg Protospacer
************ *** *******. .**
240. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgttcggcaccgacggcgccctccg Protospacer
************* ***.******. * *
241. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
242. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
243. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgtccagctcggcgccggcggcgctggcgt Protospacer
* * * *.***** ***************
244. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP006588 (Hymenobacter sp. APR13 plasmid pHA, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgt-tcggctccggcggcgctggcgg CRISPR spacer
-ccgccgcgccggctccggccgcgctggcgg Protospacer
*.**.*. .********** **********
245. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt--cggctccggcggcgctggcgg CRISPR spacer
--cgccgctggcggcgccggcggcgctggcgg Protospacer
.**.*.* **** ****************
246. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 6, identity: 0.8
cctgctgtt----cggctccggcggcgctggcgg CRISPR spacer
----cagttggggcggctccggcggcgcgggcgg Protospacer
* *** *************** *****
247. spacer 5.14|929779|30|NC_009565|CRT matches to MH029534 (Myoviridae environmental samples clone NHS-Seq2, complete sequence) position: , mismatch: 6, identity: 0.8
-cctgctgttcggctccggcggcgctggcgg CRISPR spacer
atttggt-ttcggcgctggcggcgctggcgg Protospacer
..** * ****** *.**************
248. spacer 5.16|929869|36|NC_009565|CRT matches to MT723940 (Mycobacterium phage Ellie, complete genome) position: , mismatch: 6, identity: 0.833
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgttgtcggcaacggcggtaacggcgggggtggcgg Protospacer
* .************************ .*****
249. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
250. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccgggggtggcaccgttgccgcgg Protospacer
* *********** **.********
251. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.786
gttgccgggggtgccatcgttgccggcc CRISPR spacer
ggtgccggcggtgccatcggtgccgagg Protospacer
* ****** ********** *****.
252. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
253. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.806
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ccttgcgccttgcccgccgctgccgcagggc Protospacer
*****************.****** **
254. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.824
--gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ctgtcgtc--gcagcgcgccaccaccgccaccggca Protospacer
****.* ***** ******************.
255. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_009478 (Clavibacter michiganensis subsp. michiganensis NCPPB 382 plasmid pCM1, complete sequence) position: , mismatch: 6, identity: 0.806
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgaccacttcaccgccgtcgccgccggcg Protospacer
. ** ***************.******* *.
256. spacer 1.4|369832|27|NC_009565|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.741
aagccgcccgagttcgcgagaccgaag CRISPR spacer
tgaccgcccgagttcgcgagacgttgg Protospacer
..******************* .*
257. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
taggcgccggtgaccccgccgccgacgatg Protospacer
.*********** *******.****.*
258. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
tgcgtggcggtgaccacgccgccaatggcg Protospacer
*..* ******************.*.**
259. spacer 2.2|634564|30|NC_009565|CRT matches to LR134127 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 7) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
atagcgccggtcaccgcgccgccaacgata Protospacer
*. .******* ***.************..
260. spacer 2.2|634564|30|NC_009565|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
261. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
262. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP012478 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
accacgccggtgacctcaccgcccgctgtg Protospacer
*************** *.***** .* ..*
263. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
acctcgtcggtgaccacgccgccgtgcagg Protospacer
*** **.****************. * *
264. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ccggcgccggtgaccgcgccgccaaggcag Protospacer
* .***********.********* * *
265. spacer 2.2|634564|30|NC_009565|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggcccgccgatggccacgccgccaacggca Protospacer
. * *****.**.**************.*.
266. spacer 2.2|634564|30|NC_009565|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 7, identity: 0.767
accacgccggtgaccacgccgccaacgacg CRISPR spacer
gtcgaggcggtgaccacgccgccgccgacg Protospacer
..*. * ****************. *****
267. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK977708 (Mycobacterium phage Fulbright, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
268. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MG099948 (Mycobacterium phage Philonius, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
269. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH926055 (Mycobacterium phage Chewbacca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
270. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MT723932 (Mycobacterium phage Schnauzer, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
271. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KU935726 (Mycobacterium phage Xerxes, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
272. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KU935730 (Mycobacterium phage Pipsqueaks, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
273. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH316570 (Mycobacterium phage Silvafighter, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
274. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK524518 (Mycobacterium phage Smurph, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
275. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MK524515 (Mycobacterium phage Parmesanjohn, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
276. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697585 (Mycobacterium phage Gex, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
277. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to KM588359 (Mycobacterium phage Carcharodon, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
278. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697576 (Mycobacterium phage Aggie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
279. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MH697593 (Mycobacterium phage Tapioca, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
280. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to MG099936 (Mycobacterium phage Andies, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
281. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NC_031243 (Mycobacterium phage Xeno, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
282. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to JN256079 (Mycobacterium phage Charlie, complete genome) position: , mismatch: 7, identity: 0.774
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
cgcgcgaacggcatcccgaaccgttgaccgg Protospacer
************ ***********. *
283. spacer 5.12|929683|30|NC_009565|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtcgccggcctgctggtcgggttcggatc Protospacer
* ****************** *.***
284. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
285. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
286. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
287. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
288. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
289. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ctgctgcagcctgctggtcagctccggcgc Protospacer
* .* *.***********.*********
290. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
291. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
292. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
293. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
294. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
295. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
296. spacer 5.12|929683|30|NC_009565|CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggaccggcccgctggtcggccccggctt Protospacer
**. .******.**********.*****
297. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gctgggcggcctgctggtcggctggggcgg Protospacer
* ***************** *****
298. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
299. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
300. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
301. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
302. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
303. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
304. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgcaggtcggcttcacctt Protospacer
************* ********.*. *
305. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
306. spacer 5.12|929683|30|NC_009565|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
307. spacer 5.12|929683|30|NC_009565|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
308. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
309. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
310. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
311. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
312. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
313. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
314. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
315. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
316. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
317. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
318. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
319. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
320. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
321. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
322. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
323. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
324. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
325. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
326. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
327. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
328. spacer 5.12|929683|30|NC_009565|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
329. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
330. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
331. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
332. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
333. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
334. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
335. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
336. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
337. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
338. spacer 5.12|929683|30|NC_009565|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
339. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
340. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
341. spacer 5.12|929683|30|NC_009565|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
342. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
343. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
344. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
345. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
346. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
347. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
348. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
349. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
350. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
351. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
352. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
353. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
354. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
355. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
356. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
357. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
358. spacer 5.12|929683|30|NC_009565|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
359. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
360. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
361. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
362. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
363. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
364. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
365. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggacgccggcctgctggtcgactgggaaga Protospacer
*******************.** *. *.
366. spacer 5.12|929683|30|NC_009565|CRT matches to HM560026 (Uncultured bacterium plasmid pTRACA45, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
acacgccgccctgctggtcggcttaggtcg Protospacer
****** **************. **. *
367. spacer 5.12|929683|30|NC_009565|CRT matches to NC_010867 (Neisseria lactamica plasmid pNL3.1, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gaacgccgccctgctggtcggcttagtcgc Protospacer
.****** **************. * **
368. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
agacgccggcctgctgttcggcctcgaccc Protospacer
*************** *****..**.*
369. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgggctcggcctgctgctcggcttcggcga Protospacer
**. .********** ******.*****.
370. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggc-tccggcgg CRISPR spacer
gtcggccggcctgctggtcggcgcccggct- Protospacer
****************** .*****
371. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgacggcctgctggtcgacttcatccc Protospacer
***** **************.**.*. *
372. spacer 5.12|929683|30|NC_009565|CRT matches to KT997827 (Uncultured Mediterranean phage uvDeep-CGR0-KM15-C219, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
373. spacer 5.12|929683|30|NC_009565|CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgtgtccggcctgctggtcgggttcggcac Protospacer
** **************** *.****.
374. spacer 5.12|929683|30|NC_009565|CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
tgacgccgccctgctggtcggcaaagtcga Protospacer
.******* ************* * **.
375. spacer 5.12|929683|30|NC_009565|CRT matches to KT997829 (Uncultured Mediterranean phage uvDeep-CGR0-KM22-C158, complete genome) position: , mismatch: 7, identity: 0.767
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcgccggcctgctggaccgctccgtggg Protospacer
************** * ****** **
376. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
377. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttcggggtcggctccggcggcgctggcga Protospacer
..* * *********************.
378. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctccgcgctcggctccggcggcggtggcgg Protospacer
*.. .*.*************** ******
379. spacer 5.14|929779|30|NC_009565|CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
380. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
381. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
382. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
383. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
384. spacer 5.14|929779|30|NC_009565|CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
385. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020441 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
386. spacer 5.14|929779|30|NC_009565|CRT matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tttccggctcggcgccggcggcgctggcga Protospacer
..* * *.***** ***************.
387. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
388. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
389. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
390. spacer 5.14|929779|30|NC_009565|CRT matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg- CRISPR spacer
actgctgtccggctccggcggca-tgatgtc Protospacer
*******.*************. **..*
391. spacer 5.14|929779|30|NC_009565|CRT matches to MN582086 (Siphoviridae sp. ctdEk19, complete genome) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccggccttcgacttcggcggcgctggcgg Protospacer
*.* . ****.**.***************
392. spacer 5.14|929779|30|NC_009565|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
393. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP022700 (Acetobacter tropicalis strain BDGP1 plasmid pAtBDGP1A, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gttcctccacggttccggcggcgctggcgg Protospacer
.* ** . ***.*****************
394. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
395. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
396. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
ctgcctggtcggctccggcggcgctcgtcg Protospacer
*. *** ***************** *. *
397. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 7, identity: 0.767
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tctcgggctcggccccggcggcgctggcgc Protospacer
.** *.*****.***************
398. spacer 5.16|929869|36|NC_009565|CRT matches to NC_022087 (Mycobacterium phage AnnaL29, complete genome) position: , mismatch: 7, identity: 0.806
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
cgtgatcggcaacggcggaaacggcgggagctgggg Protospacer
**************** *********. * * **
399. spacer 7.1|1576558|28|NC_009565|CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 7, identity: 0.75
gttgccgggggtgccatcgttgccggcc CRISPR spacer
agcacccggggtgccgtcgttgccggcg Protospacer
. ..** ********.***********
400. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gttgccgccatgcccgccgctgccgccggcc Protospacer
. * **** *********.**********
401. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to CP017041 (Propionibacterium sp. oral taxon 193 strain F0672 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
aacggcgtcttgcccgccgtggccgccaccg Protospacer
**. ***.************ ******. *.
402. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
403. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
404. spacer 8.3|2096605|30|NC_009565|CRT matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.767
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ttcggtaaagccgtcggtgtgcacgctgac Protospacer
*. *. ************ ********* .
405. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
406. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cccacccacttcaccgacgtcgccgccgacg Protospacer
*.************ ***.******* *.
407. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atccgccatttcaccgccgttgccgacgccg Protospacer
* * ***.**************** **.*.
408. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttggtgtcgatctcgatctggccgttgcccgca Protospacer
* **.*****.**************** *..
409. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
410. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
atgctgccgaccccgatctggtcgttttcgact Protospacer
* ********.**********.**** .**..
411. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtcgaccttc Protospacer
***************** ** ***.* * *
412. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.758
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
agctggttgatgccgatctggccgctgccggtc Protospacer
** . *..*** ************.*******
413. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cagacctcggtgaccacgccggcaacgatc Protospacer
** .************** ******.
414. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 8, identity: 0.733
accacgccggtgaccacgccgccaacgacg CRISPR spacer
ggttggccggtgaccactccgccagcgatg Protospacer
. . ************ ******.***.*
415. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgacgccggcctgctggtcgggctgacctc Protospacer
********************* .. . *
416. spacer 5.12|929683|30|NC_009565|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
417. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
418. spacer 5.12|929683|30|NC_009565|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccgcaaactcctgctggtcggcgccggcgg Protospacer
* .*. ************* *******
419. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ccttcagggcgtgctggtcggctccggcgc Protospacer
* . *** ******************
420. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_KY126370 (Enterobacter cloacae subsp. cloacae strain MN201516 plasmid pOP-I, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
421. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP054625 (Cupriavidus gilardii strain FDAARGOS_639 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggccgccggcctgctgtgcggctccgcgct Protospacer
* ************* ********
422. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
423. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
gttcaccgccctgctgatcggctccggcat Protospacer
*.*** *******.***********.
424. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP046347 (Citrobacter portucalensis strain FDAARGOS_738 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
425. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP044100 (Citrobacter werkmanii strain FDAARGOS_616 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
426. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP032156 (Mycobacterium sp. ELW1 plasmid pELW1-1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
aatcgccggcctgctggtcggtgccgcggt Protospacer
. ******************. *** *
427. spacer 5.12|929683|30|NC_009565|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
ggtgatcggcctgctggtcgtcgccggcgc Protospacer
* ..************** * ******
428. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_KP873172 (Pseudomonas aeruginosa PAO1 plasmid pAMBL1, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
429. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
430. spacer 5.12|929683|30|NC_009565|CRT matches to NC_021492 (Enterobacter sp. R4-368 plasmid pENT01, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
431. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP022156 (Escherichia coli strain ABWA45 plasmid pABWA45_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
432. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP024682 (Citrobacter freundii strain UMH14 plasmid pUMH14_2, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
catggccggcctgctgctcggcaccgggac Protospacer
*. ************ ***** **** .
433. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cgatgccggcctgctggtcggggttcccag Protospacer
***.***************** .. *.*
434. spacer 5.14|929779|30|NC_009565|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cgaccatctcggctccgacggcgctggcgc Protospacer
* * .*********.***********
435. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
436. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gccaccccgcggctccggaggcgctggcgg Protospacer
*..*. . ********* ***********
437. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
438. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
439. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
440. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
441. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
442. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
443. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
444. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
445. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
446. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcgccggcggcgctggcga Protospacer
. * *.***** ***************.
447. spacer 5.14|929779|30|NC_009565|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
tatcaggctcggcaccggcggcgctggcga Protospacer
. * *.***** ***************.
448. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgctgatcggctccggcgccggcttctc Protospacer
******* ************ ** . *
449. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gctgctgtgcggctccggcggcaaccccga Protospacer
******* *************. . **.
450. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
cctgatgttcgactccggcggcgacgcacc Protospacer
**** ******.*********** .*
451. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.733
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gcaccgcgccggctccggcggcggtggcgg Protospacer
* * .************** ******
452. spacer 5.16|929869|36|NC_009565|CRT matches to MG770216 (Mycobacterium phage Rem711, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
attcggcggcaacggcggcaacggcgcggccggcgc Protospacer
..* . ************.******* ********
453. spacer 5.16|929869|36|NC_009565|CRT matches to KY087993 (Mycobacterium phage Hammy, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
454. spacer 5.16|929869|36|NC_009565|CRT matches to MF140406 (Mycobacterium phage DarthP, complete genome) position: , mismatch: 8, identity: 0.778
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtgcagc Protospacer
** ******** *************** * .* *
455. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgggcgccttgtccgccgctgccgccgggc Protospacer
. ********.******.*********
456. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
457. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
458. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
459. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP018001 (Rhizobium sp. Y9 plasmid pY9, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
460. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
461. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
462. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcgagcgccttgcccgccgtggtcgccgccc Protospacer
. **************** *.***** *
463. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to CP036360 (Agrobacterium sp. 33MFTa1.1 plasmid p_JBx_073812, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcagcgcaatgcccgccgttgccgccgcaa Protospacer
... **** ****************** *
464. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgc--gccttgcccgccgttgccgccggca CRISPR spacer
--ccgctggccttgcccggggttgccgccgggg Protospacer
..** ********** *********** .
465. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
attgccgccctggccgccgttgccgccgatc Protospacer
* * ****.** ***************..
466. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
467. spacer 8.3|2096605|30|NC_009565|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733
tcggagaaagccgtcggtttgcacgctgtt CRISPR spacer
ccgcgagcagccgtcggtttgcgcgctgtc Protospacer
.** ... **************.******.
468. spacer 11.6|3134261|29|NC_009565|PILER-CR matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 8, identity: 0.724
tccgcgaaattcactgcgcgttattcaag CRISPR spacer
gacgcgaaatacactgcgctttattttca Protospacer
******** ******** *****. .
469. spacer 12.7|3753560|31|NC_009565|CRT matches to CP033373 (Lactobacillus fermentum strain DR9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ttagcccacttcacggccgttgccgacgcgg Protospacer
*********** ********** **. .
470. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
471. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
472. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
473. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
474. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
475. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
476. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
477. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
478. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
479. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
cgcaactccttcaccgccgctgccgccgtct Protospacer
.*. *. ***********.**********
480. spacer 12.7|3753560|31|NC_009565|CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
481. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
482. spacer 12.7|3753560|31|NC_009565|CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
gccgcccacctcaccgccgtggccgcgctgg Protospacer
. *******.********** ***** * .
483. spacer 12.7|3753560|31|NC_009565|CRT matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
ctcggtggcttcgccgccgtcgccgccgtca Protospacer
** . .****.*******.**********
484. spacer 12.7|3753560|31|NC_009565|CRT matches to NC_014213 (Meiothermus silvanus DSM 9946 plasmid pMESIL01, complete sequence) position: , mismatch: 8, identity: 0.742
aacgcccacttcaccgccgttgccgccgtca CRISPR spacer
atcgcccacttcaccggcgtttccgaccctt Protospacer
* ************** **** *** * ..
485. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatcccgatctggccgtcgccggcc Protospacer
*. .******************.*****.
486. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
487. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
488. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 9, identity: 0.727
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
cggctgccgatcccgatcaggacgtctaccttc Protospacer
***************** ** ***. * *
489. spacer 2.2|634564|30|NC_009565|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
accacgccggtgaccacgccgccaacgacg CRISPR spacer
cccacgccggtcaccacgccgctgcccggc Protospacer
********** **********.. * .
490. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NZ_CP014964 (Geobacter anodireducens strain SD-1 plasmid pSD, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
ggaacgaacggcaagccgaaatgttggtgga Protospacer
.* .**************** .*****
491. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NC_015974 (Sphingobium sp. SYK-6 plasmid pSLPG, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
492. spacer 3.1|695276|31|NC_009565|CRISPRCasFinder matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.71
agcgcgaacggcaagccgaaccgttggaccc CRISPR spacer
taagcgaacggtaagccgaaccgctgaggcg Protospacer
. ********.***********.**.. *
493. spacer 5.12|929683|30|NC_009565|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.7
cgacgccggcctgctggtcggctccggcgg CRISPR spacer
cggcgccggcctgctggtcggactgctcac Protospacer
**.****************** .. *.
494. spacer 5.14|929779|30|NC_009565|CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
495. spacer 5.14|929779|30|NC_009565|CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 9, identity: 0.7
cctgctgttcggctccggcggcgctggcgg CRISPR spacer
gaccacgttcggctccggccgcgctcgcgt Protospacer
. .************* ***** ***
496. spacer 5.16|929869|36|NC_009565|CRT matches to MF140398 (Mycobacterium phage Amohnition, complete genome) position: , mismatch: 9, identity: 0.75
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gcagatcggcaccggcggtaacggcggcggtacggc Protospacer
** ******** *************** * .. *
497. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcctcgccctgcccgccgttgccgcccacg Protospacer
.... ****.***************** .*.
498. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
tggcccgccttgccctccattgccgccggac Protospacer
. . ********** **.**********
499. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
atccttgccttgaccgccgttgccgccgctg Protospacer
* .. .****** *************** ..
500. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to MN234199 (Mycobacterium phage Ekdilam, complete genome) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accccagccctgcccgccgttgccgccgctc Protospacer
* .. ***.****************** .
501. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gcttgcgcctggcccgccgtagccggacacc Protospacer
. ******** ********* **** .*
502. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
accggcaccttgcccgccattgccgccatgt Protospacer
* . **.***********.********.
503. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP013740 (Streptomyces globisporus C-1027 plasmid pSGL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
cgggccgccttgtccgccgtggccgccgacc Protospacer
. *******.******* *******.*
504. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.71
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
agcgtggccttggccgccgttgccggcggtc Protospacer
*.. ****** ************ ***.
505. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
attgagatccgcgacgatgggtgtggcgccggcg Protospacer
.** .********.**** ***********.
506. spacer 12.5|3753419|34|NC_009565|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 9, identity: 0.735
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gcgcaccaccgcggcggtgcgggtggcgccggcg Protospacer
*. . *. *****.***** *************.
507. spacer 12.9|3753692|37|NC_009565|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.757
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
ggagacggcggtgccggagaccgcggtgtcgctgccc Protospacer
* ************ **********.***.* *
508. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
509. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtactcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
510. spacer 1.6|369967|33|NC_009565|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.697
aggctgccgatcccgatctggccgttgccggtg CRISPR spacer
ttgtattcgatgccgatctggccgtcgccggcc Protospacer
*. .**** *************.*****.
511. spacer 5.2|929224|39|NC_009565|CRT matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.744
cggcgcgggcggggccgtcacgggaaccggcgccaccgg CRISPR spacer
cacgggggccggggccgccacgggaaccggcgccccgcc Protospacer
*. * ** ********.**************** *
512. spacer 5.5|929377|36|NC_009565|CRT matches to KX683875 (Mycobacterium phage Baehexic, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
513. spacer 5.5|929377|36|NC_009565|CRT matches to KM197169 (Mycobacterium phage Piro94, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
514. spacer 5.5|929377|36|NC_009565|CRT matches to MF668269 (Mycobacterium phage Drake55, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
515. spacer 5.5|929377|36|NC_009565|CRT matches to MK284522 (Mycobacterium phage Malec, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
516. spacer 5.5|929377|36|NC_009565|CRT matches to KM677210 (Mycobacterium phage Larenn, complete genome) position: , mismatch: 10, identity: 0.722
aggggccggtgggctgttcaacggcggcggggccgg CRISPR spacer
ccttgccggtgggctgttcagcggcgggggtggcct Protospacer
****************.****** ** * *
517. spacer 5.16|929869|36|NC_009565|CRT matches to MN369764 (Mycobacterium phage Rahalelujah, complete genome) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
atctggaggcaacggcggtaacggcggggccagcac Protospacer
... . ************************.**.
518. spacer 5.16|929869|36|NC_009565|CRT matches to NZ_CP025548 (Mycobacterium paragordonae strain 49061 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.722
gctgatcggcaacggcggtaacggcggggccggcgg CRISPR spacer
gaccggcggcaacggcggaaacggcggcgccgcagc Protospacer
* . . ************ ******** **** *
519. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
520. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ttcctcgccttccccgccgctgccgccgcgg Protospacer
.. ****** *******.******** .
521. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggccagaacttccccgctgttgccgccggca Protospacer
..... . *** *****.*************
522. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NC_017590 (Thermus thermophilus JL-18 plasmid pTTJL1802, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
gggctcgcctcgcccgccgttcccgccgctc Protospacer
.. . *****.********** ****** .
523. spacer 7.10|1577173|31|NC_009565|CRISPRCasFinder matches to NZ_AP014581 (Burkholderia sp. RPE67 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.677
aattgcgccttgcccgccgttgccgccggca CRISPR spacer
ggcgtggccttggccgccgttgccggcggtc Protospacer
... ****** ************ ***.
524. spacer 7.13|1577422|34|NC_009565|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
gtcgccgtgcagccagccaccaccgccaccggcg CRISPR spacer
ccgatgatgcagccggccaccaccgccaccagca Protospacer
. .. .*******.***************.**.
525. spacer 10.9|3131768|35|NC_009565|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.714
acttgcgcgcacaacgcatccgccatccacggggc CRISPR spacer
gtcaccgcgcacaacacattcgccatccacacggt Protospacer
... **********.***.**********. **.
526. spacer 11.15|3134917|34|NC_009565|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
527. spacer 11.28|3134913|34|NC_009565|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 10, identity: 0.706
tagaaggcgatcactggaagcacggcgcttgcga CRISPR spacer
ggcaaggcgatcagtggaagctcggcggcggcac Protospacer
. ********** ******* ***** . **.
528. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cagcgcggccgcgtcggtgggggtggcgcccgcc Protospacer
. * ***** **************** **
529. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
530. spacer 12.5|3753419|34|NC_009565|CRT matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
531. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 10, identity: 0.706
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
gagaccgcccgcgatggagggggtggcgccgagc Protospacer
* .* *******.** *************.
532. spacer 12.5|3753419|34|NC_009565|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 11, identity: 0.676
gttttctcccgcgacggtgggggtggcgccggca CRISPR spacer
cgcccccggcgtgacggtggaggtggcgccggcc Protospacer
...*. **.********.************
533. spacer 12.9|3753692|37|NC_009565|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 11, identity: 0.703
cttgccggcggtgccggcgaccgcggtgccgccggcg CRISPR spacer
gccgtgcacggcgccggcggccgcggtgccgccgctg Protospacer
..*. .***.*******.************** .*
534. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcggggccaacttcaa CRISPR spacer
tcgggcggcaacggcggggccggcggtagcggcggcgcaggcgcctt Protospacer
* *******.************************ ** ..* .*
535. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
536. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
537. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
538. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
539. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
540. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
541. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
542. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
543. spacer 14.6|3961962|47|NC_009565|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 11, identity: 0.766
accggcggcagcggcggggccggcggtagcggcgg---ggccaacttcaa CRISPR spacer
gtcggcggcagcggcggtgtcggcggtagcggcggcgaggtcgatct--- Protospacer
..*************** *.*************** **.*.*..*
544. spacer 14.6|3961962|47|NC_009565|CRT matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 12, identity: 0.745
accggcggcagcggcggggccggcggtagcggcggggccaacttcaa CRISPR spacer
gtcggcggcagcggcggggacggcggcagcggcggcgggctctttgc Protospacer
..***************** ******.******** * ***..