Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009698 Clostridium botulinum A str. Hall, complete sequence 9 crisprs DEDDh,DinG,csa3,WYL,cas3,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,cas6,casR 0 11 5 0

Results visualization

1. NC_009698
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_1 1826755-1826972 Unclear NA
3 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_2 2230928-2231287 TypeIII III-B
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_3 2237924-2238219 TypeIII III-B
4 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_4 2238499-2238595 TypeIII III-B
1 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_5 2238712-2239009 TypeIII III-B
4 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_6 2239283-2239378 TypeIII III-B
1 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_7 2252865-2253023 TypeIII III-B
2 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_8 2253927-2254156 TypeIII III-B
3 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009698_9 2256374-2256534 TypeIII III-B
2 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009698_2 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT 2231155-2231190 36 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 174503-174538 0 1.0
NC_009698_2 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT 2231155-2231190 36 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 62802-62837 0 1.0
NC_009698_2 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT 2231155-2231190 36 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 207645-207680 0 1.0
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 149447-149482 0 1.0
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 128281-128316 0 1.0
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 129903-129938 0 1.0
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 80344-80379 0 1.0
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 37712-37747 0 1.0
NC_009698_2 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT 2231155-2231190 36 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 219276-219311 1 0.972
NC_009698_4 4.1|2238529|36|NC_009698|CRISPRCasFinder 2238529-2238564 36 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 47769-47804 2 0.944
NC_009698_8 8.1|2253957|36|NC_009698|CRISPRCasFinder 2253957-2253992 36 GU949551 Clostridium phage phiCD6356, complete genome 4906-4941 2 0.944
NC_009698_2 2.2|2231024|35|NC_009698|CRISPRCasFinder,CRT 2231024-2231058 35 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 30926-30960 3 0.914
NC_009698_2 2.2|2231024|35|NC_009698|CRISPRCasFinder,CRT 2231024-2231058 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 163878-163912 3 0.914
NC_009698_8 8.4|2253957|37|NC_009698|CRT 2253957-2253993 37 GU949551 Clostridium phage phiCD6356, complete genome 4906-4942 3 0.919
NC_009698_8 8.8|2254092|35|NC_009698|PILER-CR 2254092-2254126 35 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17536-17570 4 0.886
NC_009698_8 8.3|2254090|36|NC_009698|CRISPRCasFinder 2254090-2254125 36 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17535-17570 5 0.861
NC_009698_8 8.6|2254090|37|NC_009698|CRT 2254090-2254126 37 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17535-17571 6 0.838
NC_009698_8 8.8|2254092|35|NC_009698|PILER-CR 2254092-2254126 35 MN693403 Marine virus AFVG_25M412, complete genome 14464-14498 6 0.829
NC_009698_9 9.2|2256470|35|NC_009698|CRISPRCasFinder 2256470-2256504 35 MN694042 Marine virus AFVG_250M538, complete genome 50649-50683 7 0.8
NC_009698_2 2.3|2231089|36|NC_009698|CRISPRCasFinder,CRT 2231089-2231124 36 MT795651 Vibrio phage vB_VnaS-AQKL99, complete genome 5039-5074 8 0.778
NC_009698_9 9.2|2256470|35|NC_009698|CRISPRCasFinder 2256470-2256504 35 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1277029-1277063 8 0.771
NC_009698_8 8.3|2254090|36|NC_009698|CRISPRCasFinder 2254090-2254125 36 MN693403 Marine virus AFVG_25M412, complete genome 14464-14499 10 0.722
NC_009698_1 1.2|1826844|40|NC_009698|CRISPRCasFinder 1826844-1826883 40 NC_018689 Bacillus thuringiensis MC28 plasmid pMC429, complete sequence 417214-417253 11 0.725
NC_009698_8 8.6|2254090|37|NC_009698|CRT 2254090-2254126 37 MN693403 Marine virus AFVG_25M412, complete genome 14463-14499 11 0.703

1. spacer 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

2. spacer 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

3. spacer 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

4. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

5. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

6. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

7. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

8. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

9. spacer 2.4|2231155|36|NC_009698|CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 1, identity: 0.972

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagattaact	Protospacer
******************************* ****

10. spacer 4.1|2238529|36|NC_009698|CRISPRCasFinder matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 2, identity: 0.944

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaagtgttgtagtataacagaatgtaaata	Protospacer
*********.******.*******************

11. spacer 8.1|2253957|36|NC_009698|CRISPRCasFinder matches to GU949551 (Clostridium phage phiCD6356, complete genome) position: , mismatch: 2, identity: 0.944

aatagagtattcagatgaatataaattcttggaaga	CRISPR spacer
aatagagtattcagatgaatataagttcttagaaga	Protospacer
************************.*****.*****

12. spacer 2.2|2231024|35|NC_009698|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 3, identity: 0.914

cttaaatatataggtatagatcaagacgctaaaga	CRISPR spacer
ttgaaatatataggcatagatcaagacgctaaaga	Protospacer
.* ***********.********************

13. spacer 2.2|2231024|35|NC_009698|CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 3, identity: 0.914

cttaaatatataggtatagatcaagacgctaaaga	CRISPR spacer
ttgaaatatataggcatagatcaagacgctaaaga	Protospacer
.* ***********.********************

14. spacer 8.4|2253957|37|NC_009698|CRT matches to GU949551 (Clostridium phage phiCD6356, complete genome) position: , mismatch: 3, identity: 0.919

aatagagtattcagatgaatataaattcttggaagaa	CRISPR spacer
aatagagtattcagatgaatataagttcttagaagat	Protospacer
************************.*****.***** 

15. spacer 8.8|2254092|35|NC_009698|PILER-CR matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 4, identity: 0.886

gaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
aaatctataacagtttcagaagtagaaaaaaatat	Protospacer
.* .*********************** *******

16. spacer 8.3|2254090|36|NC_009698|CRISPRCasFinder matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 5, identity: 0.861

cgaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
taaatctataacagtttcagaagtagaaaaaaatat	Protospacer
..* .*********************** *******

17. spacer 8.6|2254090|37|NC_009698|CRT matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 6, identity: 0.838

cgaccctataacagtttcagaagtagaacaaaatatg	CRISPR spacer
taaatctataacagtttcagaagtagaaaaaaatata	Protospacer
..* .*********************** *******.

18. spacer 8.8|2254092|35|NC_009698|PILER-CR matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 6, identity: 0.829

gacccta-taacagtttcagaagtagaacaaaatat	CRISPR spacer
-acagtactaacagcttcagaagtagcacaaaattt	Protospacer
 **  ** ******.*********** ******* *

19. spacer 9.2|2256470|35|NC_009698|CRISPRCasFinder matches to MN694042 (Marine virus AFVG_250M538, complete genome) position: , mismatch: 7, identity: 0.8

tttaatattttttctatatccataggcttaaaatc	CRISPR spacer
tttaatatttcttctttatccatagtgtttataac	Protospacer
**********.**** *********  ** * * *

20. spacer 2.3|2231089|36|NC_009698|CRISPRCasFinder,CRT matches to MT795651 (Vibrio phage vB_VnaS-AQKL99, complete genome) position: , mismatch: 8, identity: 0.778

tcttaacctttaattacattatatattataagttca	CRISPR spacer
gcttaacctttaaatacattatacattaccaaccca	Protospacer
 ************ *********.****. *...**

21. spacer 9.2|2256470|35|NC_009698|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.771

tttaatattttttctatatccataggcttaaaatc--	CRISPR spacer
agtaatattttttctatattcataggc--agcttccg	Protospacer
  *****************.*******  *.  **  

22. spacer 8.3|2254090|36|NC_009698|CRISPRCasFinder matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 10, identity: 0.722

cgaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
cacagtactaacagcttcagaagtagcacaaaattt	Protospacer
*.   .  ******.*********** ******* *

23. spacer 1.2|1826844|40|NC_009698|CRISPRCasFinder matches to NC_018689 (Bacillus thuringiensis MC28 plasmid pMC429, complete sequence) position: , mismatch: 11, identity: 0.725

tatttaaaggatttaaactta---catcatttagatctaagag	CRISPR spacer
tatttaaaggatttaaacttagttcattacataggttatc---	Protospacer
*********************   ***.*. ***.*.      

24. spacer 8.6|2254090|37|NC_009698|CRT matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 11, identity: 0.703

cgaccctataacagtttcagaagtagaacaaaatatg	CRISPR spacer
cacagtactaacagcttcagaagtagcacaaaatttt	Protospacer
*.   .  ******.*********** ******* * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 559688 : 569102 7 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 874374 : 886093 6 Clostridium_botulinum_D_phage(50.0%) NA NA
DBSCAN-SWA_3 1655277 : 1662343 8 uncultured_phage(33.33%) NA NA
DBSCAN-SWA_4 2926606 : 2936075 7 Synechococcus_phage(42.86%) NA NA
DBSCAN-SWA_5 3084525 : 3103405 23 Clostridium_phage(94.74%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage