Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009831 Shewanella sediminis HAW-EB3, complete sequence 10 crisprs cas3,csa3,DEDDh,RT,DinG,WYL 1 1 2 0

Results visualization

1. NC_009831
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_1 824102-824201 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_2 1811036-1811167 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_3 2570852-2570927 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_4 2770224-2770324 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_5 3434165-3434265 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_6 4447498-4447580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_7 4484888-4485002 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_8 4597368-4597477 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_9 4627929-4628030 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009831_10 5193725-5193953 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 NC_009831.1 4447292-4447316 0 1.0

1. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to position: 4447292-4447316, mismatch: 0, identity: 1.0

aatgtgagctcccctgacaaggcgg	CRISPR spacer
aatgtgagctcccctgacaaggcgg	Protospacer
*************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 NZ_CP027375 Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence 111359-111383 5 0.8
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 NZ_CP027458 Escherichia coli strain 88-3493 plasmid unnamed, complete sequence 91918-91942 5 0.8
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 NZ_CP028383 Escherichia coli strain RM10466 plasmid pRM10466-2, complete sequence 4465-4489 5 0.8
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 CP027580 Escherichia coli strain 2013C-4282 plasmid unnamed1 22501-22525 5 0.8
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 CP027581 Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence 108938-108962 5 0.8
NC_009831_6 6.1|4447527|25|NC_009831|CRISPRCasFinder 4447527-4447551 25 NZ_CP028610 Escherichia coli strain 142 plasmid pTA142-3, complete sequence 53708-53732 5 0.8

1. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to NZ_CP027375 (Escherichia coli strain 05-3629 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

2. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to NZ_CP027458 (Escherichia coli strain 88-3493 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

3. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to NZ_CP028383 (Escherichia coli strain RM10466 plasmid pRM10466-2, complete sequence) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

4. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to CP027580 (Escherichia coli strain 2013C-4282 plasmid unnamed1) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

5. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to CP027581 (Escherichia coli strain 2013C-4282 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

6. spacer 6.1|4447527|25|NC_009831|CRISPRCasFinder matches to NZ_CP028610 (Escherichia coli strain 142 plasmid pTA142-3, complete sequence) position: , mismatch: 5, identity: 0.8

aatgtgagctcccctgacaaggcgg	CRISPR spacer
gttgtgagctcacctgacaaggcat	Protospacer
. ********* ***********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1507119 : 1516294 8 Staphylococcus_phage(57.14%) NA NA
DBSCAN-SWA_2 2574151 : 2585752 12 uncultured_Caudovirales_phage(50.0%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage