Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_009792 Citrobacter koseri ATCC BAA-895, complete sequence 9 crisprs DEDDh,DinG,cas3,cas6f,PD-DExK 1 4 1 0
NC_009793 Citrobacter koseri ATCC BAA-895 plasmid pCKO3, complete sequence 0 crisprs NA 0 0 0 0
NC_009794 Citrobacter koseri ATCC BAA-895 plasmid pCKO2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. NC_009792
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_1 395325-395409 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_2 454477-454573 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_3 1284639-1284722 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_4 1315452-1315534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_5 1685191-1685387 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_6 1815563-1815660 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_7 1999531-1999680 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_8 2033031-2033240 Unclear I-F
3 spacers
cas6f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_009792_9 3969025-3969124 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 NC_009792.1 2855482-2855512 2 0.935

1. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to position: 2855482-2855512, mismatch: 2, identity: 0.935

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
agcccggtggcgttaacgcttaccgggcctg	Protospacer
************.***.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 126542-126572 4 0.871
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 93000-93030 4 0.871
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 105156-105186 4 0.871
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 LR134132 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12 21699-21729 5 0.839
NC_009792_4 4.1|1315478|31|NC_009792|CRISPRCasFinder 1315478-1315508 31 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 583046-583076 5 0.839
NC_009792_6 6.1|1815596|32|NC_009792|CRISPRCasFinder 1815596-1815627 32 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 73210-73241 6 0.812
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 107540-107581 6 0.857
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 73998-74039 6 0.857
NC_009792_6 6.1|1815596|32|NC_009792|CRISPRCasFinder 1815596-1815627 32 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33079-33110 8 0.75
NC_009792_6 6.1|1815596|32|NC_009792|CRISPRCasFinder 1815596-1815627 32 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141013-141044 8 0.75
NC_009792_6 6.1|1815596|32|NC_009792|CRISPRCasFinder 1815596-1815627 32 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 170856-170887 9 0.719
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 5111-5152 9 0.786
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 1993-2034 9 0.786
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 121585-121626 9 0.786
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 35167-35208 9 0.786
NC_009792_8 8.2|2033120|31|NC_009792|CRISPRCasFinder,CRT,PILER-CR 2033120-2033150 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1509005-1509035 9 0.71
NC_009792_8 8.2|2033120|31|NC_009792|CRISPRCasFinder,CRT,PILER-CR 2033120-2033150 31 MK279840 Mycobacterium phage JacoRen57, complete genome 23209-23239 9 0.71
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 428566-428607 10 0.762
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP022016 Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence 383089-383130 10 0.762
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 387864-387905 10 0.762
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 69701-69742 11 0.738
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP019203 Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence 58482-58523 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_LN868945 Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence 68712-68753 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP019195 Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence 49193-49234 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 86023-86064 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 114544-114585 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP013339 Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence 48153-48194 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 135217-135258 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 111788-111829 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 82235-82276 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 44400-44441 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP010179 Escherichia coli strain H15 plasmid A, complete genome 37346-37387 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 43832-43873 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 43321-43362 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 47961-48002 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 43722-43763 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 42130-42171 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 42130-42171 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP042894 Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_01, complete sequence 80424-80465 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 44592-44633 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 44592-44633 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 42131-42172 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP039329 Citrobacter portucalensis strain Effluent_1 plasmid unnamed2, complete sequence 44449-44490 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 142780-142821 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 183633-183674 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 38609-38650 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 44592-44633 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 42079-42120 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 42129-42170 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP016838 Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence 96142-96183 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 NZ_CP022659 Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence 31613-31654 12 0.714
NC_009792_7 7.1|1999585|42|NC_009792|CRISPRCasFinder 1999585-1999626 42 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 97243-97284 13 0.69

1. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 4, identity: 0.871

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
tgcccggtggcgctgacgcttaccgggccta	Protospacer
 *************.*.*************.

2. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 4, identity: 0.871

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
tgcccggtggcgctgacgcttaccgggccta	Protospacer
 *************.*.*************.

3. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 4, identity: 0.871

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
tgcccggtggcgcgaacgcttaccgggccta	Protospacer
 ************ **.*************.

4. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 5, identity: 0.839

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
agcccggaggcgctaacgcttaccgggctgt	Protospacer
******* ********.***********.  

5. spacer 4.1|1315478|31|NC_009792|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.839

agcccggtggcgctaatgcttaccgggcctg	CRISPR spacer
tccccggtggcgctaacgcttaccggggcta	Protospacer
  **************.********** **.

6. spacer 6.1|1815596|32|NC_009792|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 6, identity: 0.812

acatcgccttatccggcctacgggaagcatat-	CRISPR spacer
tctacgccttatccggcctacgggtag-atacg	Protospacer
 *  ******************** ** ***. 

7. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 6, identity: 0.857

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cctgtaggcctgataagcgtagcgccatcaggcgcgcaaaaa	Protospacer
***********************************      *

8. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.857

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cctgtaggcctgataagcgtagcgccatcaggcgcgcaaaaa	Protospacer
***********************************      *

9. spacer 6.1|1815596|32|NC_009792|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 8, identity: 0.75

acatcgccttatccggcctacgggaagcatat	CRISPR spacer
tgaacgcctgatccggcctacggtaagcctga	Protospacer
  * ***** ************* **** *. 

10. spacer 6.1|1815596|32|NC_009792|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 8, identity: 0.75

acatcgccttatccggcctacgggaagcatat	CRISPR spacer
tgaacgcctgatccggcctacggtaagcctga	Protospacer
  * ***** ************* **** *. 

11. spacer 6.1|1815596|32|NC_009792|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.719

acatcgccttatccggcctacgggaagcatat	CRISPR spacer
tgaacgccttatccgacctacgggtagtgcgt	Protospacer
  * ***********.******** **....*

12. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 9, identity: 0.786

cctgtaggcctgataagcgtagcgccatcaggcg--ctgcttta	CRISPR spacer
aatgtaggcctgataagcgcagcgccatcaggcaaccggcac--	Protospacer
  *****************.*************.  * ** .  

13. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.786

cctgtaggcctgataagcgtagcgccatcaggcg--ctgcttta	CRISPR spacer
aatgtaggcctgataagcgcagcgccatcaggcaaccggcac--	Protospacer
  *****************.*************.  * ** .  

14. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 9, identity: 0.786

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
tccgtaggcctgataagcgcagcgccatcaggcgtttactgc	Protospacer
.*.****************.**************.*  .*  

15. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 9, identity: 0.786

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cttgtaggcccgataagcgtagcgccatcgggcaatatctga	Protospacer
*.********.******************.***. *...* *

16. spacer 8.2|2033120|31|NC_009792|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.71

acttggcgtgctgatgggcgaagttctgcga	CRISPR spacer
cagcggcgtgctgctgggcgaaggtctgtcc	Protospacer
   .********* ********* ****.  

17. spacer 8.2|2033120|31|NC_009792|CRISPRCasFinder,CRT,PILER-CR matches to MK279840 (Mycobacterium phage JacoRen57, complete genome) position: , mismatch: 9, identity: 0.71

acttggcgtgctgatgggcgaagttctgcga	CRISPR spacer
tgcaggcgagctggtgggcgaagttctccac	Protospacer
  . **** ****.************* *. 

18. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 10, identity: 0.762

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cttgtaggcctgataagcgaagcgccatcaggcaatagagat	Protospacer
*.***************** *************. *.     

19. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP022016 (Salmonella enterica subsp. enterica serovar India str. SA20085604 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.762

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
tacgtaggcctgataagcgcagcgccatcaggcgtcagatca	Protospacer
. .****************.**************...  *.*

20. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.762

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cgcgtaggcctgataagcgaagcgccatcaggcaaggcacac	Protospacer
* .**************** *************.  ** .  

21. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 11, identity: 0.738

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aacgtaggcctgataagcgaagcgccatcaggcgttaaagcc	Protospacer
  .**************** **************.*.   . 

22. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP019203 (Salmonella enterica subsp. enterica serovar Infantis strain CFSAN003307 plasmid pCFSAN003307, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
accgtaggcccgataagcgtagcgccatcgggcaacagggaa	Protospacer
 *.*******.******************.***. ..    *

23. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_LN868945 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 3, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
tacgtaggccggataagcgtagcgccgtcaggcagtcaggtg	Protospacer
. .******* ***************.******. *    *.

24. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

25. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

26. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

27. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP013339 (Raoultella ornithinolytica strain Yangling I2 plasmid pKPYL1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

28. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

29. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

30. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

31. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

32. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

33. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP010179 (Escherichia coli strain H15 plasmid A, complete genome) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

34. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

35. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

36. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

37. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

38. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

39. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

40. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

41. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

42. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

43. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP042894 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_01, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aacgtaggcctgataagcgaagcgccatcaggcataagtgcc	Protospacer
  .**************** *************.. . * . 

44. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

45. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

46. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

47. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

48. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

49. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

50. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP039329 (Citrobacter portucalensis strain Effluent_1 plasmid unnamed2, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

51. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

52. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

53. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

54. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

55. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

56. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

57. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

58. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

59. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

60. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

61. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

62. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

63. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
aatgtaggcctgataagcgaagcgccatcaggaataagtgcc	Protospacer
  ***************** ************ .. . * . 

64. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to NZ_CP022659 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence) position: , mismatch: 12, identity: 0.714

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
accgtaggcccgataagcgtagcgccatcgggcaacagggaa	Protospacer
 *.*******.******************.***. ..    *

65. spacer 7.1|1999585|42|NC_009792|CRISPRCasFinder matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 13, identity: 0.69

cctgtaggcctgataagcgtagcgccatcaggcgctgcttta	CRISPR spacer
cgcgtaggccggataagcgtagcgccatccggcataaaagcg	Protospacer
* .******* ****************** ***.. .   ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1753662 : 1796752 58 Escherichia_phage(27.91%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage