Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010172 Methylorubrum extorquens PA1, complete sequence 5 crisprs csa3,DEDDh,WYL,cas3 1 2 2 0

Results visualization

1. NC_010172
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010172_1 2134186-2134388 Orphan NA
3 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010172_2 2136420-2136510 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010172_3 2700341-2700612 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010172_4 4012808-4012892 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010172_5 4640799-4640887 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_010172_4 4.1|4012831|39|NC_010172|CRISPRCasFinder 4012831-4012869 39 NC_010172.1 2717865-2717903 2 0.949
NC_010172_4 4.1|4012831|39|NC_010172|CRISPRCasFinder 4012831-4012869 39 NC_010172.1 4640786-4640824 2 0.949
NC_010172_4 4.1|4012831|39|NC_010172|CRISPRCasFinder 4012831-4012869 39 NC_010172.1 5229931-5229969 2 0.949

1. spacer 4.1|4012831|39|NC_010172|CRISPRCasFinder matches to position: 2717865-2717903, mismatch: 2, identity: 0.949

cccgaaaggtgggcaccggctttcggaaaaagatgatgc	CRISPR spacer
cccgaaaggtggtctccggctttcggaaaaagatgatgc	Protospacer
************ * ************************

2. spacer 4.1|4012831|39|NC_010172|CRISPRCasFinder matches to position: 4640786-4640824, mismatch: 2, identity: 0.949

cccgaaaggtgggcaccggctttcggaaaaagatgatgc	CRISPR spacer
cccgaaaggtggtcgccggctttcggaaaaagatgatgc	Protospacer
************ *.************************

3. spacer 4.1|4012831|39|NC_010172|CRISPRCasFinder matches to position: 5229931-5229969, mismatch: 2, identity: 0.949

cccgaaaggtgggcaccggctttcggaaaaagatgatgc	CRISPR spacer
cccgaaaggtggcctccggctttcggaaaaagatgatgc	Protospacer
************ * ************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010172_3 3.2|2700418|25|NC_010172|CRISPRCasFinder 2700418-2700442 25 NC_015314 Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence 87393-87417 4 0.84
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP010408 Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence 46469-46499 5 0.839
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_LR134451 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence 745-775 5 0.839
NC_010172_3 3.2|2700418|25|NC_010172|CRISPRCasFinder 2700418-2700442 25 NC_010683 Ralstonia pickettii 12J plasmid pRPIC01, complete sequence 37260-37284 5 0.8
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 256369-256399 6 0.806
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP039697 Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence 681520-681550 6 0.806
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP023549 Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence 62521-62551 6 0.806
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP048420 Sphingomonas insulae strain KCTC 12872 plasmid unnamed2, complete sequence 70285-70315 6 0.806
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 30928-30958 6 0.806
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP018784 Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence 498426-498456 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 CP007644 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence 21554-21584 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050095 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b1, complete sequence 109422-109452 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050083 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence 165370-165400 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050100 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence 101792-101822 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 306491-306521 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP025017 Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence 97123-97153 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP049733 Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence 156629-156659 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP053443 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eC, complete sequence 77895-77925 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP048284 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence 98593-98623 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP054026 Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence 129091-129121 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 255135-255165 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP053207 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence 187281-187311 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 359536-359566 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NC_012854 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence 227486-227516 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP018232 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence 218220-218250 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 350341-350371 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 359720-359750 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 22889-22919 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 238448-238478 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 289251-289281 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 496042-496072 8 0.742
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP028969 Aminobacter sp. MSH1 plasmid pUSP1, complete sequence 272474-272504 9 0.71
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP026266 Aminobacter sp. MSH1 plasmid pAM01, complete sequence 269751-269781 9 0.71
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 CP047389 Agrobacterium sp. CGMCC 11546 plasmid pA 170400-170430 9 0.71
NC_010172_3 3.1|2700364|31|NC_010172|CRISPRCasFinder 2700364-2700394 31 NZ_CP015007 Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence 276449-276479 9 0.71

1. spacer 3.2|2700418|25|NC_010172|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 4, identity: 0.84

tagcggccaagccgatttccaggcc	CRISPR spacer
gcgcggcccagccgatgtccaggcc	Protospacer
  ****** ******* ********

2. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP010408 (Streptomyces vietnamensis strain GIMV4.0001 plasmid pSVL1, complete sequence) position: , mismatch: 5, identity: 0.839

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
catccgccgcgacacgatcgccttcggcgac	Protospacer
**.  **************.** ********

3. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 5, identity: 0.839

-cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
gcac-caccgcgacccgatccccatcggcgac	Protospacer
 ***  .******* ***** ***********

4. spacer 3.2|2700418|25|NC_010172|CRISPRCasFinder matches to NC_010683 (Ralstonia pickettii 12J plasmid pRPIC01, complete sequence) position: , mismatch: 5, identity: 0.8

tagcggccaagccgatttccaggcc	CRISPR spacer
tcgcggccaagccgatttccattgg	Protospacer
* *******************    

5. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.806

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
ctacgacggcgacacgatcaccatcggcaac	Protospacer
*   *.* ********************.**

6. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 6, identity: 0.806

-cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cgacaagac-cggcacgatcaccatcggcgac	Protospacer
  **..* * **.*******************

7. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cacggtccgcgacacgatcaccgacttcgtc	Protospacer
***** ****************. *  ** *

8. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP048420 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.806

-cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cgacaagac-cggcacgatcaccatcggcgac	Protospacer
  **..* * **.*******************

9. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.806

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
caagctctgcggcatgatcaccatcggcgac	Protospacer
** *  *.***.**.****************

10. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cggcaaacgcgacaccgtcaccatcggcgac	Protospacer
*.  .. ******** .**************

11. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
ctatcccggcgtcacgatcaccatccgcgac	Protospacer
*     * *** ************* *****

12. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050095 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b1, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccgtcggcgac	Protospacer
* *   . ***********.**.********

13. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

14. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050100 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b3, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cgcccctggcgacacgatcgccttcggcgac	Protospacer
*.*   . ***********.** ********

15. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccgtcggcgac	Protospacer
* *   . ***********.**.********

16. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccctcggcgac	Protospacer
* *   . ***********.** ********

17. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

18. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP053443 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eC, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cgcccctggcgacacgatcgccttcggcgac	Protospacer
*.*   . ***********.** ********

19. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP048284 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248b, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccgtcggcgac	Protospacer
* *   . ***********.**.********

20. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP054026 (Rhizobium sp. JKLM12A2 plasmid pPR12A205, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccgtcggcgac	Protospacer
* *   . ***********.**.********

21. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccgtcggcgac	Protospacer
* *   . ***********.**.********

22. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

23. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

24. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cgcccttggcgacacgatcgccgtcggcgac	Protospacer
*.*   . ***********.**.********

25. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP018232 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

26. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

27. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

28. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

29. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

30. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

31. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 8, identity: 0.742

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
cccccttggcgacacgatcgccttcggcgac	Protospacer
* *   . ***********.** ********

32. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 9, identity: 0.71

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
ggcaagccgcgatccgatcaccatcggctca	Protospacer
 .*..*******. **************   

33. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 9, identity: 0.71

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
ggcaagccgcgatccgatcaccatcggctca	Protospacer
 .*..*******. **************   

34. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to CP047389 (Agrobacterium sp. CGMCC 11546 plasmid pA) position: , mismatch: 9, identity: 0.71

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
agtcgatcgcaacgcgatcaccatcggcgag	Protospacer
 .. *..***.**.**************** 

35. spacer 3.1|2700364|31|NC_010172|CRISPRCasFinder matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 9, identity: 0.71

cacgggccgcgacacgatcaccatcggcgac	CRISPR spacer
gttgagccgcgccacgatcgccatcggcagt	Protospacer
  .*.****** *******.********...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 168919 : 173047 6 Acidovorax_phage(33.33%) NA NA
DBSCAN-SWA_2 1589389 : 1600923 14 Paracoccus_phage(28.57%) protease,head,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage