Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_011978 Thermotoga neapolitana DSM 4359, complete sequence 8 crisprs cas14k,DEDDh,cas6,csx1,cas10,cas7,cas5,cas3HD,cas3,cas4,cas1,cas2,WYL,csa3 0 2 3 0

Results visualization

1. NC_011978
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_1 75115-75482 Orphan III-A
5 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_2 271824-272186 Orphan III-A
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_3 311329-311756 Orphan III-A
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_4 704816-705245 III-A
6 spacers
cas10,csx1,cas6,cas7,cas5,cas3HD,cas3,cas4,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_5 713422-715291 NA
28 spacers
cas2,cas1,cas4,cas3,cas3HD,cas5,cas7,cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_6 739743-739910 Orphan III-A
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_7 961160-961393 Orphan III-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_011978_8 1152061-1152421 Orphan III-A
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_011978_6 6.1|739776|34|NC_011978|CRISPRCasFinder 739776-739809 34 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 162741-162774 9 0.735
NC_011978_4 4.10|705115|35|NC_011978|CRISPRCasFinder 705115-705149 35 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 168499-168533 10 0.714

1. spacer 6.1|739776|34|NC_011978|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.735

aggtctgtgtctttgaccgtcgccaggaactgct	CRISPR spacer
ccgtagatctcgttgaccgtcgccacgaactgcg	Protospacer
  **  .* ** ************* ******* 

2. spacer 4.10|705115|35|NC_011978|CRISPRCasFinder matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.714

tttttctttgcgtgaagtaagcgtttgggaattct	CRISPR spacer
ggattgtttgcgggaagtaagcgtttggatgtcat	Protospacer
   ** ****** ***************. .*. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 720755 : 728381 10 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 1273075 : 1290957 16 Bacillus_phage(25.0%) NA NA
DBSCAN-SWA_3 1431788 : 1440507 8 Powai_lake_megavirus(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage