Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012468 Streptococcus pneumoniae 70585, complete sequence 3 crisprs DEDDh,cas3,DinG,RT 0 1 11 0

Results visualization

1. NC_012468
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012468_1 137959-138054 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012468_2 1461339-1461475 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012468_3 1804729-1804815 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012468_3 3.1|1804758|29|NC_012468|CRISPRCasFinder 1804758-1804786 29 KY065475 Streptococcus phage IPP35, complete genome 21733-21761 2 0.931

1. spacer 3.1|1804758|29|NC_012468|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 2, identity: 0.931

gaaatttgtcctttctcgagcttagctga	CRISPR spacer
gaaatttgtcctttctcgagcttagcttt	Protospacer
***************************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4381 : 80151 84 Streptococcus_phage(85.25%) capsid,bacteriocin,tail,tRNA,protease,holin,terminase,integrase,transposase attL 22564:22623|attR 67612:67683
DBSCAN-SWA_2 83217 : 94674 7 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 147194 : 180682 30 Planktothrix_phage(33.33%) tRNA,bacteriocin NA
DBSCAN-SWA_4 354852 : 402513 37 Streptococcus_phage(30.0%) protease,holin,transposase NA
DBSCAN-SWA_5 479482 : 542608 58 Planktothrix_phage(11.11%) tRNA,bacteriocin,transposase NA
DBSCAN-SWA_6 895553 : 905195 10 Streptococcus_phage(88.89%) holin NA
DBSCAN-SWA_7 1205459 : 1270453 58 Indivirus(17.65%) transposase,protease,holin NA
DBSCAN-SWA_8 1371385 : 1414005 44 Streptococcus_phage(23.08%) tRNA,holin,transposase NA
DBSCAN-SWA_9 1485791 : 1492542 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_10 1785721 : 1793053 9 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_11 2162534 : 2171288 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage