Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_012469 Streptococcus pneumoniae Taiwan19F-14, complete genome 2 crisprs DEDDh,cas3,DinG 0 1 12 0

Results visualization

1. NC_012469
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012469_1 1081776-1081879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_012469_2 1410988-1411120 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_012469_1 1.1|1081809|38|NC_012469|CRISPRCasFinder 1081809-1081846 38 KY065475 Streptococcus phage IPP35, complete genome 23044-23081 4 0.895
NC_012469_1 1.1|1081809|38|NC_012469|CRISPRCasFinder 1081809-1081846 38 MK448453 Streptococcus satellite phage Javan360, complete genome 13985-14022 5 0.868

1. spacer 1.1|1081809|38|NC_012469|CRISPRCasFinder matches to KY065475 (Streptococcus phage IPP35, complete genome) position: , mismatch: 4, identity: 0.895

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacacaaaaataggctccataatatct	Protospacer
  *************  *********************

2. spacer 1.1|1081809|38|NC_012469|CRISPRCasFinder matches to MK448453 (Streptococcus satellite phage Javan360, complete genome) position: , mismatch: 5, identity: 0.868

ccctttttttctacaataaaataggctccataatatct	CRISPR spacer
gactttttttctacaacaaaataggctccataatattc	Protospacer
  **************.*******************..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 13047 : 23357 11 Streptococcus_phage(62.5%) integrase,transposase attL 13278:13292|attR 29829:29843
DBSCAN-SWA_2 60384 : 71840 8 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_3 113247 : 154683 48 Streptococcus_phage(50.0%) tRNA,transposase,bacteriocin NA
DBSCAN-SWA_4 198095 : 208847 14 Streptococcus_phage(77.78%) integrase attL 198074:198090|attR 210739:210755
DBSCAN-SWA_5 348795 : 402942 45 Streptococcus_phage(25.0%) transposase,protease,holin NA
DBSCAN-SWA_6 475180 : 536532 55 Streptococcus_phage(20.0%) tRNA,transposase,bacteriocin NA
DBSCAN-SWA_7 768416 : 775422 10 Streptococcus_phage(42.86%) NA NA
DBSCAN-SWA_8 1199789 : 1210185 11 Streptococcus_phage(70.0%) NA NA
DBSCAN-SWA_9 1435014 : 1441773 9 Streptococcus_phage(50.0%) protease NA
DBSCAN-SWA_10 1696681 : 1704054 10 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_11 1785495 : 1812067 31 Streptococcus_phage(92.0%) transposase,bacteriocin NA
DBSCAN-SWA_12 2090529 : 2099283 9 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage