Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
NC_010334 Shewanella halifaxensis HAW-EB4, complete sequence 8 crisprs cas3,RT,csa3,cas2,PD-DExK,DEDDh,DinG 1 1 3 0

Results visualization

1. NC_010334
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_1 237391-237482 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_2 393183-393255 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_3 1052479-1052592 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_4 1164546-1164655 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_5 4228161-4228253 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_6 4385118-4385201 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_7 4915502-4915625 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
NC_010334_8 5122185-5122291 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
NC_010334_2 2.1|393207|25|NC_010334|CRISPRCasFinder 393207-393231 25 NC_010334.1 341880-341904 1 0.96
NC_010334_2 2.1|393207|25|NC_010334|CRISPRCasFinder 393207-393231 25 NC_010334.1 998608-998632 1 0.96
NC_010334_2 2.1|393207|25|NC_010334|CRISPRCasFinder 393207-393231 25 NC_010334.1 694373-694397 2 0.92

1. spacer 2.1|393207|25|NC_010334|CRISPRCasFinder matches to position: 341880-341904, mismatch: 1, identity: 0.96

tcctcgcagcgcagcgtcctaggat	CRISPR spacer
tcctcgcagcgaagcgtcctaggat	Protospacer
*********** *************

2. spacer 2.1|393207|25|NC_010334|CRISPRCasFinder matches to position: 998608-998632, mismatch: 1, identity: 0.96

tcctcgcagcgcagcgtcctaggat	CRISPR spacer
tcctcgcagcgaagcgtcctaggat	Protospacer
*********** *************

3. spacer 2.1|393207|25|NC_010334|CRISPRCasFinder matches to position: 694373-694397, mismatch: 2, identity: 0.92

tcctcgcagcgcagcgtcctaggat	CRISPR spacer
tcctcgcagcgaagcgccctaggat	Protospacer
*********** ****.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
NC_010334_5 5.1|4228194|27|NC_010334|CRISPRCasFinder 4228194-4228220 27 NZ_CP017942 Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence 513011-513037 6 0.778

1. spacer 5.1|4228194|27|NC_010334|CRISPRCasFinder matches to NZ_CP017942 (Phyllobacterium zundukense strain Tri-48 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

gtaaagggtcagcccagaacgggagga	CRISPR spacer
ggctagggtcagcccagtacgggagat	Protospacer
*   ************* *******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1461213 : 1468763 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1491194 : 1501925 7 uncultured_Mediterranean_phage(33.33%) tRNA NA
DBSCAN-SWA_3 1583978 : 1659242 83 Pseudoalteromonas_phage(42.11%) integrase,capsid,terminase,plate,head,tRNA,portal,tail attL 1583315:1583362|attR 1619850:1619897
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage